Incidental Mutation 'R6750:Eif2b4'
ID530685
Institutional Source Beutler Lab
Gene Symbol Eif2b4
Ensembl Gene ENSMUSG00000029145
Gene Nameeukaryotic translation initiation factor 2B, subunit 4 delta
SynonymsEif2b
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6750 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location31187558-31193430 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31189960 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 333 (I333V)
Ref Sequence ENSEMBL: ENSMUSP00000130880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031029] [ENSMUST00000077693] [ENSMUST00000114603] [ENSMUST00000166769] [ENSMUST00000200730] [ENSMUST00000201154] [ENSMUST00000201535] [ENSMUST00000201679] [ENSMUST00000202124] [ENSMUST00000202758]
Predicted Effect probably benign
Transcript: ENSMUST00000031029
SMART Domains Protein: ENSMUSP00000031029
Gene: ENSMUSG00000029146

DomainStartEndE-ValueType
PX 1 105 3.42e-24 SMART
B41 113 274 4.05e-2 SMART
low complexity region 324 342 N/A INTRINSIC
low complexity region 428 441 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000077693
AA Change: I313V

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000076875
Gene: ENSMUSG00000029145
AA Change: I313V

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
coiled coil region 29 60 N/A INTRINSIC
coiled coil region 93 122 N/A INTRINSIC
Pfam:IF-2B 219 510 3.4e-97 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114603
AA Change: I333V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110250
Gene: ENSMUSG00000029145
AA Change: I333V

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
coiled coil region 49 80 N/A INTRINSIC
coiled coil region 113 142 N/A INTRINSIC
Pfam:IF-2B 239 530 3.8e-97 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166769
AA Change: I333V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130880
Gene: ENSMUSG00000029145
AA Change: I333V

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
coiled coil region 49 80 N/A INTRINSIC
coiled coil region 113 142 N/A INTRINSIC
Pfam:IF-2B 239 530 3.8e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200724
Predicted Effect probably benign
Transcript: ENSMUST00000200730
SMART Domains Protein: ENSMUSP00000144504
Gene: ENSMUSG00000029146

DomainStartEndE-ValueType
PX 1 87 2.3e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200741
Predicted Effect probably benign
Transcript: ENSMUST00000200929
Predicted Effect probably benign
Transcript: ENSMUST00000200977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200983
Predicted Effect probably benign
Transcript: ENSMUST00000201154
SMART Domains Protein: ENSMUSP00000143802
Gene: ENSMUSG00000029145

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
coiled coil region 49 80 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201535
SMART Domains Protein: ENSMUSP00000144643
Gene: ENSMUSG00000029146

DomainStartEndE-ValueType
Blast:PX 1 23 3e-7 BLAST
PDB:3LUI|C 1 23 3e-8 PDB
low complexity region 24 35 N/A INTRINSIC
Blast:B41 36 169 5e-92 BLAST
PDB:4GXB|A 36 169 4e-90 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000201679
SMART Domains Protein: ENSMUSP00000144688
Gene: ENSMUSG00000029146

DomainStartEndE-ValueType
Pfam:PX 6 67 2.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202032
Predicted Effect probably benign
Transcript: ENSMUST00000202124
SMART Domains Protein: ENSMUSP00000144168
Gene: ENSMUSG00000029146

DomainStartEndE-ValueType
Blast:PX 1 31 6e-8 BLAST
PDB:3LUI|C 1 31 4e-9 PDB
low complexity region 41 54 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202616
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202743
Predicted Effect possibly damaging
Transcript: ENSMUST00000202758
AA Change: I355V

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144361
Gene: ENSMUSG00000029145
AA Change: I355V

DomainStartEndE-ValueType
coiled coil region 71 102 N/A INTRINSIC
coiled coil region 135 164 N/A INTRINSIC
Pfam:IF-2B 261 552 2.3e-97 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotic initiation factor 2B (EIF2B), which is necessary for protein synthesis, is a GTP exchange factor composed of five different subunits. The protein encoded by this gene is the fourth, or delta, subunit. Defects in this gene are a cause of leukoencephalopathy with vanishing white matter (VWM) and ovarioleukodystrophy. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,398 S477T possibly damaging Het
5430419D17Rik T A 7: 131,288,245 probably benign Het
Adal A T 2: 121,142,649 L62F probably damaging Het
Akap13 C T 7: 75,739,458 P2375S probably benign Het
Apob T A 12: 7,997,853 L931Q probably damaging Het
Arcn1 A G 9: 44,750,394 V391A possibly damaging Het
Ccdc162 A T 10: 41,561,226 I1729N possibly damaging Het
Cd24a T C 10: 43,582,725 L86P unknown Het
Churc1 C A 12: 76,775,631 H71Q probably damaging Het
Clcn3 A G 8: 60,914,775 L780P possibly damaging Het
Cldn17 C T 16: 88,506,307 G178E possibly damaging Het
Cmah A G 13: 24,464,252 Y345C probably damaging Het
Cntnap5b C T 1: 100,274,499 S357L probably damaging Het
Col6a6 A G 9: 105,783,680 I410T probably damaging Het
Crmp1 T C 5: 37,265,322 probably null Het
Csmd2 A C 4: 128,197,225 N186H possibly damaging Het
Cyp1a1 A T 9: 57,700,256 M56L probably benign Het
D2hgdh G C 1: 93,826,407 R56P probably benign Het
Dapk2 A G 9: 66,220,752 E104G probably damaging Het
Dld T C 12: 31,332,214 N498S probably benign Het
Dyrk4 G T 6: 126,898,955 Q106K probably benign Het
F5 A G 1: 164,193,507 T1184A possibly damaging Het
Fbxl6 C T 15: 76,538,412 G102D probably damaging Het
Foxa1 C T 12: 57,542,610 G275R probably benign Het
Fryl A G 5: 73,022,232 I2944T probably damaging Het
Gm597 C A 1: 28,777,414 E512D probably damaging Het
Gna15 T C 10: 81,514,283 D95G probably benign Het
Greb1 T A 12: 16,688,583 M1460L probably benign Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Herc2 T C 7: 56,097,447 I444T probably damaging Het
Ifngr1 T A 10: 19,609,351 M366K probably benign Het
Krt27 C T 11: 99,348,980 E253K probably damaging Het
Micalcl C T 7: 112,381,839 T406I probably damaging Het
Mocs2 T G 13: 114,826,248 D156E probably damaging Het
Mprip A T 11: 59,696,131 K43N probably damaging Het
Myo5b A T 18: 74,617,035 T190S possibly damaging Het
Naa25 C T 5: 121,408,309 T86M probably damaging Het
Ncam1 T C 9: 49,567,339 D163G probably damaging Het
Nlrp4f A T 13: 65,181,654 Y908* probably null Het
Nlrp9b T A 7: 20,023,234 L132* probably null Het
Nrg1 A C 8: 31,818,096 S679A probably damaging Het
Olfr3 C A 2: 36,812,942 R50M possibly damaging Het
Olfr656 C T 7: 104,618,113 R145C probably damaging Het
Paqr9 A T 9: 95,560,997 T347S probably damaging Het
Pcdhb21 T C 18: 37,514,448 L210P probably damaging Het
Pdzd7 T G 19: 45,027,748 D978A probably benign Het
Pkd1l1 A T 11: 8,973,217 S17T unknown Het
Plcz1 T C 6: 140,028,438 K93E possibly damaging Het
Pom121l2 G C 13: 21,981,937 R126P probably damaging Het
Prkg1 C T 19: 31,764,561 E88K probably benign Het
Psme4 A T 11: 30,853,203 D15V probably damaging Het
Ptprf A G 4: 118,231,731 V625A probably benign Het
Rab27a G A 9: 73,085,008 S106N probably damaging Het
Rasa4 A G 5: 136,100,948 T261A probably benign Het
Sardh T C 2: 27,228,257 D487G probably benign Het
Sec16a A G 2: 26,440,018 Y662H probably benign Het
Sema3d T A 5: 12,585,100 L711* probably null Het
Sept14 T A 5: 129,696,117 Y152F probably damaging Het
Smc5 A G 19: 23,242,640 L411P probably damaging Het
Spg7 T A 8: 123,073,911 V39E probably damaging Het
Tas2r117 A G 6: 132,802,854 probably benign Het
Tle1 A T 4: 72,122,450 I631N probably damaging Het
Tmed3 T A 9: 89,699,790 S207C probably damaging Het
Tmem59l G A 8: 70,486,372 P51S probably benign Het
Trpc3 A G 3: 36,624,393 Y848H probably damaging Het
Tsen2 T C 6: 115,549,920 F66S probably damaging Het
Ttll5 T A 12: 85,956,610 S216R probably damaging Het
Usp22 A T 11: 61,157,216 V426E probably damaging Het
Vmn2r76 T C 7: 86,225,906 N621S probably damaging Het
Wdr75 A G 1: 45,817,379 T521A probably damaging Het
Wrnip1 T A 13: 32,802,756 D173E probably damaging Het
Zfp317 G A 9: 19,647,804 G438D probably damaging Het
Zscan10 T A 17: 23,607,190 S109T possibly damaging Het
Other mutations in Eif2b4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Eif2b4 APN 5 31187767 missense probably benign 0.02
IGL02525:Eif2b4 APN 5 31189618 missense probably damaging 0.99
IGL03178:Eif2b4 APN 5 31187653 missense probably damaging 1.00
IGL03267:Eif2b4 APN 5 31192659 missense possibly damaging 0.90
IGL03379:Eif2b4 APN 5 31190011 splice site probably benign
IGL03397:Eif2b4 APN 5 31187653 missense probably damaging 1.00
R0346:Eif2b4 UTSW 5 31188108 splice site probably benign
R1549:Eif2b4 UTSW 5 31192921 missense possibly damaging 0.72
R1636:Eif2b4 UTSW 5 31192266 unclassified probably null
R1753:Eif2b4 UTSW 5 31192940 missense probably benign 0.00
R2263:Eif2b4 UTSW 5 31192574 splice site probably benign
R2317:Eif2b4 UTSW 5 31191576 unclassified probably null
R3808:Eif2b4 UTSW 5 31191168 missense possibly damaging 0.95
R3809:Eif2b4 UTSW 5 31191168 missense possibly damaging 0.95
R4746:Eif2b4 UTSW 5 31187653 missense probably damaging 1.00
R4752:Eif2b4 UTSW 5 31191231 nonsense probably null
R4798:Eif2b4 UTSW 5 31189520 intron probably benign
R4895:Eif2b4 UTSW 5 31192954 missense probably benign 0.00
R4936:Eif2b4 UTSW 5 31192897 missense probably benign 0.00
R5588:Eif2b4 UTSW 5 31192173 nonsense probably null
R5660:Eif2b4 UTSW 5 31191156 missense probably benign 0.00
R6363:Eif2b4 UTSW 5 31191239 missense probably damaging 0.99
R6653:Eif2b4 UTSW 5 31192207 missense possibly damaging 0.89
R7062:Eif2b4 UTSW 5 31192831 missense probably benign
R7221:Eif2b4 UTSW 5 31187787 missense possibly damaging 0.55
R7360:Eif2b4 UTSW 5 31191375 missense probably benign 0.08
R7779:Eif2b4 UTSW 5 31190654 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGTGACTGGCTGGTAGC -3'
(R):5'- TGCACGCAGACCCATTGTTATG -3'

Sequencing Primer
(F):5'- TAGCCAGCCTGTCTGCAAAG -3'
(R):5'- CTGACCTAGAGCTCAGTAGATTGGC -3'
Posted On2018-08-01