Incidental Mutation 'R6750:Rab27a'
ID530712
Institutional Source Beutler Lab
Gene Symbol Rab27a
Ensembl Gene ENSMUSG00000032202
Gene NameRAB27A, member RAS oncogene family
Synonyms4933437C11Rik, 2210402C08Rik, 2410003M20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.499) question?
Stock #R6750 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location73044854-73097629 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 73085008 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 106 (S106N)
Ref Sequence ENSEMBL: ENSMUSP00000139310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034722] [ENSMUST00000184146]
Predicted Effect probably damaging
Transcript: ENSMUST00000034722
AA Change: S106N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034722
Gene: ENSMUSG00000032202
AA Change: S106N

DomainStartEndE-ValueType
RAB 10 184 9.9e-92 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184146
AA Change: S106N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139310
Gene: ENSMUSG00000032202
AA Change: S106N

DomainStartEndE-ValueType
RAB 10 184 9.9e-92 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184575
Meta Mutation Damage Score 0.398 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the Rab family of proteins, which is the largest family within the Ras superfamily of GTPases. This gene product is thought to regulate vesicular transport, together with its specific effectors. Mutations in this gene cause several defects, including actin-based melanosome transport defects and immunodeficiency. Mutations in the human ortholog of this gene are associated with Griscelli syndrome type 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygotes have abnormal melanocyte development producing abnormal pigmentation and a gray coat color. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,398 S477T possibly damaging Het
5430419D17Rik T A 7: 131,288,245 probably benign Het
Adal A T 2: 121,142,649 L62F probably damaging Het
Akap13 C T 7: 75,739,458 P2375S probably benign Het
Apob T A 12: 7,997,853 L931Q probably damaging Het
Arcn1 A G 9: 44,750,394 V391A possibly damaging Het
Ccdc162 A T 10: 41,561,226 I1729N possibly damaging Het
Cd24a T C 10: 43,582,725 L86P unknown Het
Churc1 C A 12: 76,775,631 H71Q probably damaging Het
Clcn3 A G 8: 60,914,775 L780P possibly damaging Het
Cldn17 C T 16: 88,506,307 G178E possibly damaging Het
Cmah A G 13: 24,464,252 Y345C probably damaging Het
Cntnap5b C T 1: 100,274,499 S357L probably damaging Het
Col6a6 A G 9: 105,783,680 I410T probably damaging Het
Crmp1 T C 5: 37,265,322 probably null Het
Csmd2 A C 4: 128,197,225 N186H possibly damaging Het
Cyp1a1 A T 9: 57,700,256 M56L probably benign Het
D2hgdh G C 1: 93,826,407 R56P probably benign Het
Dapk2 A G 9: 66,220,752 E104G probably damaging Het
Dld T C 12: 31,332,214 N498S probably benign Het
Dyrk4 G T 6: 126,898,955 Q106K probably benign Het
Eif2b4 T C 5: 31,189,960 I333V probably damaging Het
F5 A G 1: 164,193,507 T1184A possibly damaging Het
Fbxl6 C T 15: 76,538,412 G102D probably damaging Het
Foxa1 C T 12: 57,542,610 G275R probably benign Het
Fryl A G 5: 73,022,232 I2944T probably damaging Het
Gm597 C A 1: 28,777,414 E512D probably damaging Het
Gna15 T C 10: 81,514,283 D95G probably benign Het
Greb1 T A 12: 16,688,583 M1460L probably benign Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Herc2 T C 7: 56,097,447 I444T probably damaging Het
Ifngr1 T A 10: 19,609,351 M366K probably benign Het
Krt27 C T 11: 99,348,980 E253K probably damaging Het
Micalcl C T 7: 112,381,839 T406I probably damaging Het
Mocs2 T G 13: 114,826,248 D156E probably damaging Het
Mprip A T 11: 59,696,131 K43N probably damaging Het
Myo5b A T 18: 74,617,035 T190S possibly damaging Het
Naa25 C T 5: 121,408,309 T86M probably damaging Het
Ncam1 T C 9: 49,567,339 D163G probably damaging Het
Nlrp4f A T 13: 65,181,654 Y908* probably null Het
Nlrp9b T A 7: 20,023,234 L132* probably null Het
Nrg1 A C 8: 31,818,096 S679A probably damaging Het
Olfr3 C A 2: 36,812,942 R50M possibly damaging Het
Olfr656 C T 7: 104,618,113 R145C probably damaging Het
Paqr9 A T 9: 95,560,997 T347S probably damaging Het
Pcdhb21 T C 18: 37,514,448 L210P probably damaging Het
Pdzd7 T G 19: 45,027,748 D978A probably benign Het
Pkd1l1 A T 11: 8,973,217 S17T unknown Het
Plcz1 T C 6: 140,028,438 K93E possibly damaging Het
Pom121l2 G C 13: 21,981,937 R126P probably damaging Het
Prkg1 C T 19: 31,764,561 E88K probably benign Het
Psme4 A T 11: 30,853,203 D15V probably damaging Het
Ptprf A G 4: 118,231,731 V625A probably benign Het
Rasa4 A G 5: 136,100,948 T261A probably benign Het
Sardh T C 2: 27,228,257 D487G probably benign Het
Sec16a A G 2: 26,440,018 Y662H probably benign Het
Sema3d T A 5: 12,585,100 L711* probably null Het
Sept14 T A 5: 129,696,117 Y152F probably damaging Het
Smc5 A G 19: 23,242,640 L411P probably damaging Het
Spg7 T A 8: 123,073,911 V39E probably damaging Het
Tas2r117 A G 6: 132,802,854 probably benign Het
Tle1 A T 4: 72,122,450 I631N probably damaging Het
Tmed3 T A 9: 89,699,790 S207C probably damaging Het
Tmem59l G A 8: 70,486,372 P51S probably benign Het
Trpc3 A G 3: 36,624,393 Y848H probably damaging Het
Tsen2 T C 6: 115,549,920 F66S probably damaging Het
Ttll5 T A 12: 85,956,610 S216R probably damaging Het
Usp22 A T 11: 61,157,216 V426E probably damaging Het
Vmn2r76 T C 7: 86,225,906 N621S probably damaging Het
Wdr75 A G 1: 45,817,379 T521A probably damaging Het
Wrnip1 T A 13: 32,802,756 D173E probably damaging Het
Zfp317 G A 9: 19,647,804 G438D probably damaging Het
Zscan10 T A 17: 23,607,190 S109T possibly damaging Het
Other mutations in Rab27a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01144:Rab27a APN 9 73075568 critical splice donor site probably null
IGL02000:Rab27a APN 9 73084972 missense probably damaging 1.00
concrete UTSW 9 73082409 missense possibly damaging 0.89
geodude UTSW 9 73084981 missense probably damaging 1.00
ivan UTSW 9 73075544 missense probably damaging 0.99
R0644:Rab27a UTSW 9 73095423 missense probably benign 0.01
R0671:Rab27a UTSW 9 73075433 missense probably damaging 1.00
R1481:Rab27a UTSW 9 73082402 missense probably benign 0.13
R1522:Rab27a UTSW 9 73075482 missense probably damaging 1.00
R1531:Rab27a UTSW 9 73095403 missense probably benign
R1634:Rab27a UTSW 9 73075569 critical splice donor site probably null
R1950:Rab27a UTSW 9 73075469 missense probably damaging 1.00
R2497:Rab27a UTSW 9 73084981 missense probably damaging 1.00
R4083:Rab27a UTSW 9 73082439 missense probably damaging 0.96
R4094:Rab27a UTSW 9 73075544 missense probably damaging 0.99
R5027:Rab27a UTSW 9 73095413 missense probably benign 0.01
R5881:Rab27a UTSW 9 73085039 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACAGTTCAGGAGTGGGACCATG -3'
(R):5'- AGCTGAAGGGCTTATTCTTAGTAGC -3'

Sequencing Primer
(F):5'- AGGATCTGGCTGGTATACTCCAC -3'
(R):5'- TTAGTAGCCTCGACACTGAGCTG -3'
Posted On2018-08-01