Mutagenetix > Incidental Mutation

Incidental Mutation 'R6750:Psme4'

530721

Institutional Source

Beutler Lab

Gene Symbol

Psme4

Ensembl Gene

ENSMUSG00000040850

Gene Name

proteasome (prosome, macropain) activator subunit 4

Synonyms

MMRRC Submission

Accession Numbers

Genbank: NM_134013

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6750 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30771726-30880361 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 30853203 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 15 (D15V)

Ref Sequence

ENSEMBL: ENSMUSP00000114537 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041231] [ENSMUST00000129824]

AlphaFold

Q5SSW2

Predicted Effect

probably damaging
Transcript: ENSMUST00000041231
AA Change: D1516V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: D1516V

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
Pfam:BLM10_mid	330	828	8.8e-119	PFAM
SCOP:d1b3ua_	1183	1716	3e-14	SMART
Pfam:DUF3437	1756	1843	5.3e-39	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000129824
AA Change: D15V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.7022

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.7%

Validation Efficiency

100% (75/75)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	A	T	17: 33,066,398	S477T	possibly damaging	Het
5430419D17Rik	T	A	7: 131,288,245		probably benign	Het
Adal	A	T	2: 121,142,649	L62F	probably damaging	Het
Akap13	C	T	7: 75,739,458	P2375S	probably benign	Het
Apob	T	A	12: 7,997,853	L931Q	probably damaging	Het
Arcn1	A	G	9: 44,750,394	V391A	possibly damaging	Het
Ccdc162	A	T	10: 41,561,226	I1729N	possibly damaging	Het
Cd24a	T	C	10: 43,582,725	L86P	unknown	Het
Churc1	C	A	12: 76,775,631	H71Q	probably damaging	Het
Clcn3	A	G	8: 60,914,775	L780P	possibly damaging	Het
Cldn17	C	T	16: 88,506,307	G178E	possibly damaging	Het
Cmah	A	G	13: 24,464,252	Y345C	probably damaging	Het
Cntnap5b	C	T	1: 100,274,499	S357L	probably damaging	Het
Col6a6	A	G	9: 105,783,680	I410T	probably damaging	Het
Crmp1	T	C	5: 37,265,322		probably null	Het
Csmd2	A	C	4: 128,197,225	N186H	possibly damaging	Het
Cyp1a1	A	T	9: 57,700,256	M56L	probably benign	Het
D2hgdh	G	C	1: 93,826,407	R56P	probably benign	Het
Dapk2	A	G	9: 66,220,752	E104G	probably damaging	Het
Dld	T	C	12: 31,332,214	N498S	probably benign	Het
Dyrk4	G	T	6: 126,898,955	Q106K	probably benign	Het
Eif2b4	T	C	5: 31,189,960	I333V	probably damaging	Het
F5	A	G	1: 164,193,507	T1184A	possibly damaging	Het
Fbxl6	C	T	15: 76,538,412	G102D	probably damaging	Het
Foxa1	C	T	12: 57,542,610	G275R	probably benign	Het
Fryl	A	G	5: 73,022,232	I2944T	probably damaging	Het
Gm597	C	A	1: 28,777,414	E512D	probably damaging	Het
Gna15	T	C	10: 81,514,283	D95G	probably benign	Het
Greb1	T	A	12: 16,688,583	M1460L	probably benign	Het
Herc1	TCCC	TCC	9: 66,501,188		probably null	Het
Herc2	T	C	7: 56,097,447	I444T	probably damaging	Het
Ifngr1	T	A	10: 19,609,351	M366K	probably benign	Het
Krt27	C	T	11: 99,348,980	E253K	probably damaging	Het
Micalcl	C	T	7: 112,381,839	T406I	probably damaging	Het
Mocs2	T	G	13: 114,826,248	D156E	probably damaging	Het
Mprip	A	T	11: 59,696,131	K43N	probably damaging	Het
Myo5b	A	T	18: 74,617,035	T190S	possibly damaging	Het
Naa25	C	T	5: 121,408,309	T86M	probably damaging	Het
Ncam1	T	C	9: 49,567,339	D163G	probably damaging	Het
Nlrp4f	A	T	13: 65,181,654	Y908*	probably null	Het
Nlrp9b	T	A	7: 20,023,234	L132*	probably null	Het
Nrg1	A	C	8: 31,818,096	S679A	probably damaging	Het
Olfr3	C	A	2: 36,812,942	R50M	possibly damaging	Het
Olfr656	C	T	7: 104,618,113	R145C	probably damaging	Het
Paqr9	A	T	9: 95,560,997	T347S	probably damaging	Het
Pcdhb21	T	C	18: 37,514,448	L210P	probably damaging	Het
Pdzd7	T	G	19: 45,027,748	D978A	probably benign	Het
Pkd1l1	A	T	11: 8,973,217	S17T	unknown	Het
Plcz1	T	C	6: 140,028,438	K93E	possibly damaging	Het
Pom121l2	G	C	13: 21,981,937	R126P	probably damaging	Het
Prkg1	C	T	19: 31,764,561	E88K	probably benign	Het
Ptprf	A	G	4: 118,231,731	V625A	probably benign	Het
Rab27a	G	A	9: 73,085,008	S106N	probably damaging	Het
Rasa4	A	G	5: 136,100,948	T261A	probably benign	Het
Sardh	T	C	2: 27,228,257	D487G	probably benign	Het
Sec16a	A	G	2: 26,440,018	Y662H	probably benign	Het
Sema3d	T	A	5: 12,585,100	L711*	probably null	Het
Sept14	T	A	5: 129,696,117	Y152F	probably damaging	Het
Smc5	A	G	19: 23,242,640	L411P	probably damaging	Het
Spg7	T	A	8: 123,073,911	V39E	probably damaging	Het
Tas2r117	A	G	6: 132,802,854		probably benign	Het
Tle1	A	T	4: 72,122,450	I631N	probably damaging	Het
Tmed3	T	A	9: 89,699,790	S207C	probably damaging	Het
Tmem59l	G	A	8: 70,486,372	P51S	probably benign	Het
Trpc3	A	G	3: 36,624,393	Y848H	probably damaging	Het
Tsen2	T	C	6: 115,549,920	F66S	probably damaging	Het
Ttll5	T	A	12: 85,956,610	S216R	probably damaging	Het
Usp22	A	T	11: 61,157,216	V426E	probably damaging	Het
Vmn2r76	T	C	7: 86,225,906	N621S	probably damaging	Het
Wdr75	A	G	1: 45,817,379	T521A	probably damaging	Het
Wrnip1	T	A	13: 32,802,756	D173E	probably damaging	Het
Zfp317	G	A	9: 19,647,804	G438D	probably damaging	Het
Zscan10	T	A	17: 23,607,190	S109T	possibly damaging	Het

Other mutations in Psme4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Psme4	APN	11	30815710	critical splice donor site	probably null
IGL00401:Psme4	APN	11	30821079	splice site	probably benign
IGL00475:Psme4	APN	11	30845252	missense	probably benign	0.14
IGL00576:Psme4	APN	11	30823145	missense	possibly damaging	0.50
IGL00817:Psme4	APN	11	30820129	missense	probably benign	0.01
IGL01525:Psme4	APN	11	30809936	splice site	probably benign
IGL01862:Psme4	APN	11	30812038	nonsense	probably null
IGL02310:Psme4	APN	11	30837484	missense	probably benign	0.06
IGL02477:Psme4	APN	11	30842083	missense	probably damaging	0.99
IGL02545:Psme4	APN	11	30841586	missense	possibly damaging	0.81
IGL02608:Psme4	APN	11	30820944	missense	probably benign	0.34
IGL02621:Psme4	APN	11	30848131	missense	probably benign
IGL02822:Psme4	APN	11	30848204	unclassified	probably benign
IGL02833:Psme4	APN	11	30850715	unclassified	probably benign
IGL02964:Psme4	APN	11	30791095	nonsense	probably null
IGL03273:Psme4	APN	11	30848130	missense	probably damaging	1.00
IGL03348:Psme4	APN	11	30876796	missense	probably damaging	1.00
IGL03382:Psme4	APN	11	30807788	missense	possibly damaging	0.94
H2330:Psme4	UTSW	11	30851210	missense	probably benign	0.17
PIT4378001:Psme4	UTSW	11	30821079	splice site	probably benign
R0276:Psme4	UTSW	11	30811980	missense	probably damaging	1.00
R0462:Psme4	UTSW	11	30848117	missense	probably damaging	1.00
R0685:Psme4	UTSW	11	30878415	missense	probably damaging	1.00
R0766:Psme4	UTSW	11	30807687	splice site	probably null
R0830:Psme4	UTSW	11	30807797	missense	possibly damaging	0.53
R0940:Psme4	UTSW	11	30815264	missense	possibly damaging	0.53
R1018:Psme4	UTSW	11	30804310	missense	probably damaging	1.00
R1312:Psme4	UTSW	11	30807687	splice site	probably null
R1448:Psme4	UTSW	11	30852744	missense	probably damaging	1.00
R1713:Psme4	UTSW	11	30806310	missense	probably damaging	1.00
R1732:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R1813:Psme4	UTSW	11	30804353	missense	probably benign	0.14
R1905:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1907:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1911:Psme4	UTSW	11	30815658	missense	probably benign	0.02
R1956:Psme4	UTSW	11	30832424	missense	probably damaging	0.99
R1974:Psme4	UTSW	11	30819011	missense	probably benign	0.00
R1980:Psme4	UTSW	11	30832615	missense	possibly damaging	0.84
R1986:Psme4	UTSW	11	30830352	missense	probably benign	0.01
R2046:Psme4	UTSW	11	30817723	splice site	probably benign
R2142:Psme4	UTSW	11	30820998	missense	possibly damaging	0.89
R2698:Psme4	UTSW	11	30874282	critical splice donor site	probably null
R2844:Psme4	UTSW	11	30845173	splice site	probably benign
R3807:Psme4	UTSW	11	30856027	splice site	probably null
R3876:Psme4	UTSW	11	30856068	missense	probably damaging	0.99
R4420:Psme4	UTSW	11	30812028	missense	possibly damaging	0.67
R4584:Psme4	UTSW	11	30834318	missense	probably damaging	1.00
R4615:Psme4	UTSW	11	30834287	missense	probably benign	0.02
R4714:Psme4	UTSW	11	30832573	missense	probably benign	0.02
R5008:Psme4	UTSW	11	30856896	intron	probably benign
R5109:Psme4	UTSW	11	30791095	nonsense	probably null
R5155:Psme4	UTSW	11	30876806	missense	probably damaging	1.00
R5199:Psme4	UTSW	11	30853272	missense	probably benign	0.00
R5205:Psme4	UTSW	11	30832666	intron	probably benign
R5452:Psme4	UTSW	11	30791168	missense	probably benign
R5491:Psme4	UTSW	11	30815246	missense	possibly damaging	0.63
R5685:Psme4	UTSW	11	30809837	missense	probably damaging	0.99
R5764:Psme4	UTSW	11	30772364	intron	probably benign
R5853:Psme4	UTSW	11	30791234	critical splice donor site	probably null
R5865:Psme4	UTSW	11	30791993	missense	possibly damaging	0.95
R5903:Psme4	UTSW	11	30841589	missense	probably benign	0.28
R5927:Psme4	UTSW	11	30804294	missense	possibly damaging	0.82
R6004:Psme4	UTSW	11	30856896	intron	probably benign
R6102:Psme4	UTSW	11	30865567	missense	probably damaging	1.00
R6247:Psme4	UTSW	11	30853245	missense	possibly damaging	0.60
R6527:Psme4	UTSW	11	30832175	missense	probably benign
R6885:Psme4	UTSW	11	30834307	nonsense	probably null
R6939:Psme4	UTSW	11	30837291	missense	probably damaging	0.99
R6945:Psme4	UTSW	11	30837437	missense	probably benign	0.06
R7029:Psme4	UTSW	11	30772474	intron	probably benign
R7049:Psme4	UTSW	11	30813904	splice site	probably null
R7098:Psme4	UTSW	11	30850661	missense	probably damaging	0.99
R7107:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R7223:Psme4	UTSW	11	30874226	missense	probably benign	0.33
R7319:Psme4	UTSW	11	30807790	missense	probably benign	0.00
R7375:Psme4	UTSW	11	30772700	splice site	probably null
R7410:Psme4	UTSW	11	30815279	nonsense	probably null
R7469:Psme4	UTSW	11	30802837	missense	probably benign	0.20
R7651:Psme4	UTSW	11	30837334	missense	probably damaging	0.98
R7679:Psme4	UTSW	11	30878425	missense	probably damaging	0.99
R7681:Psme4	UTSW	11	30791975	missense	possibly damaging	0.63
R7822:Psme4	UTSW	11	30874245	missense	probably benign
R8013:Psme4	UTSW	11	30804320	missense	probably benign	0.06
R8130:Psme4	UTSW	11	30842026	missense	probably damaging	1.00
R8323:Psme4	UTSW	11	30843532	missense	probably damaging	0.99
R8330:Psme4	UTSW	11	30843583	missense	probably benign	0.00
R8363:Psme4	UTSW	11	30812139	missense	probably damaging	1.00
R8491:Psme4	UTSW	11	30772161	missense	possibly damaging	0.90
R8690:Psme4	UTSW	11	30837319	missense	probably benign	0.00
R8696:Psme4	UTSW	11	30809896	missense	probably damaging	0.99
R8743:Psme4	UTSW	11	30878467	missense	probably damaging	1.00
R8998:Psme4	UTSW	11	30838957	missense	possibly damaging	0.78
R9241:Psme4	UTSW	11	30865576	missense	probably damaging	1.00
R9657:Psme4	UTSW	11	30838980	missense	probably benign	0.00
R9736:Psme4	UTSW	11	30847411	missense	probably damaging	0.99
R9744:Psme4	UTSW	11	30815294	critical splice donor site	probably null
R9746:Psme4	UTSW	11	30876868	nonsense	probably null
V5088:Psme4	UTSW	11	30851210	missense	probably benign	0.17
X0063:Psme4	UTSW	11	30832600	missense	possibly damaging	0.66
Z1176:Psme4	UTSW	11	30843522	missense	possibly damaging	0.87
Z1177:Psme4	UTSW	11	30806311	missense	probably damaging	1.00
Z1177:Psme4	UTSW	11	30812138	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGCACTGTACTCAGAAGCCAC -3'
(R):5'- GTTTAATGCCCTGAGTTCGTTC -3'

Sequencing Primer
(F):5'- GCAGCCATCATACTACAGGGTTG -3'
(R):5'- GAGTTCGTTCATCTTCTTCACCAATG -3'

Posted On

2018-08-01