Mutagenetix > Incidental Mutation

Incidental Mutation 'R6750:Greb1'

530726

Institutional Source

Beutler Lab

Gene Symbol

Greb1

Ensembl Gene

ENSMUSG00000036523

Gene Name

gene regulated by estrogen in breast cancer protein

Synonyms

5730583K22Rik

MMRRC Submission

044867-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6750 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

16670615-16800886 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 16688583 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 1460 (M1460L)

Ref Sequence

ENSEMBL: ENSMUSP00000124348 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048064] [ENSMUST00000159120] [ENSMUST00000162112]

AlphaFold

Q3UHK3

Predicted Effect

probably benign
Transcript: ENSMUST00000048064
AA Change: M1460L

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523
AA Change: M1460L

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1954	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000159120
AA Change: M1432L

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523
AA Change: M1432L

Domain	Start	End	E-Value	Type
low complexity region	52	71	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	437	453	N/A	INTRINSIC
low complexity region	480	503	N/A	INTRINSIC
low complexity region	631	643	N/A	INTRINSIC
low complexity region	1100	1118	N/A	INTRINSIC
low complexity region	1196	1207	N/A	INTRINSIC
low complexity region	1251	1265	N/A	INTRINSIC
low complexity region	1596	1607	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160755

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161036

Predicted Effect

probably benign
Transcript: ENSMUST00000162112
AA Change: M1460L

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000124348
Gene: ENSMUSG00000036523
AA Change: M1460L

Domain	Start	End	E-Value	Type
low complexity region	52	71	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	437	453	N/A	INTRINSIC
low complexity region	480	503	N/A	INTRINSIC
low complexity region	631	643	N/A	INTRINSIC
low complexity region	1128	1146	N/A	INTRINSIC
low complexity region	1224	1235	N/A	INTRINSIC
low complexity region	1279	1293	N/A	INTRINSIC
low complexity region	1624	1635	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223113

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.7%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an estrogen-responsive gene that is an early response gene in the estrogen receptor-regulated pathway. It is thought to play an important role in hormone-responsive tissues and cancer. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	A	T	17: 33,066,398	S477T	possibly damaging	Het
5430419D17Rik	T	A	7: 131,288,245		probably benign	Het
Adal	A	T	2: 121,142,649	L62F	probably damaging	Het
Akap13	C	T	7: 75,739,458	P2375S	probably benign	Het
Apob	T	A	12: 7,997,853	L931Q	probably damaging	Het
Arcn1	A	G	9: 44,750,394	V391A	possibly damaging	Het
Ccdc162	A	T	10: 41,561,226	I1729N	possibly damaging	Het
Cd24a	T	C	10: 43,582,725	L86P	unknown	Het
Churc1	C	A	12: 76,775,631	H71Q	probably damaging	Het
Clcn3	A	G	8: 60,914,775	L780P	possibly damaging	Het
Cldn17	C	T	16: 88,506,307	G178E	possibly damaging	Het
Cmah	A	G	13: 24,464,252	Y345C	probably damaging	Het
Cntnap5b	C	T	1: 100,274,499	S357L	probably damaging	Het
Col6a6	A	G	9: 105,783,680	I410T	probably damaging	Het
Crmp1	T	C	5: 37,265,322		probably null	Het
Csmd2	A	C	4: 128,197,225	N186H	possibly damaging	Het
Cyp1a1	A	T	9: 57,700,256	M56L	probably benign	Het
D2hgdh	G	C	1: 93,826,407	R56P	probably benign	Het
Dapk2	A	G	9: 66,220,752	E104G	probably damaging	Het
Dld	T	C	12: 31,332,214	N498S	probably benign	Het
Dyrk4	G	T	6: 126,898,955	Q106K	probably benign	Het
Eif2b4	T	C	5: 31,189,960	I333V	probably damaging	Het
F5	A	G	1: 164,193,507	T1184A	possibly damaging	Het
Fbxl6	C	T	15: 76,538,412	G102D	probably damaging	Het
Foxa1	C	T	12: 57,542,610	G275R	probably benign	Het
Fryl	A	G	5: 73,022,232	I2944T	probably damaging	Het
Gm597	C	A	1: 28,777,414	E512D	probably damaging	Het
Gna15	T	C	10: 81,514,283	D95G	probably benign	Het
Herc1	TCCC	TCC	9: 66,501,188		probably null	Het
Herc2	T	C	7: 56,097,447	I444T	probably damaging	Het
Ifngr1	T	A	10: 19,609,351	M366K	probably benign	Het
Krt27	C	T	11: 99,348,980	E253K	probably damaging	Het
Micalcl	C	T	7: 112,381,839	T406I	probably damaging	Het
Mocs2	T	G	13: 114,826,248	D156E	probably damaging	Het
Mprip	A	T	11: 59,696,131	K43N	probably damaging	Het
Myo5b	A	T	18: 74,617,035	T190S	possibly damaging	Het
Naa25	C	T	5: 121,408,309	T86M	probably damaging	Het
Ncam1	T	C	9: 49,567,339	D163G	probably damaging	Het
Nlrp4f	A	T	13: 65,181,654	Y908*	probably null	Het
Nlrp9b	T	A	7: 20,023,234	L132*	probably null	Het
Nrg1	A	C	8: 31,818,096	S679A	probably damaging	Het
Olfr3	C	A	2: 36,812,942	R50M	possibly damaging	Het
Olfr656	C	T	7: 104,618,113	R145C	probably damaging	Het
Paqr9	A	T	9: 95,560,997	T347S	probably damaging	Het
Pcdhb21	T	C	18: 37,514,448	L210P	probably damaging	Het
Pdzd7	T	G	19: 45,027,748	D978A	probably benign	Het
Pkd1l1	A	T	11: 8,973,217	S17T	unknown	Het
Plcz1	T	C	6: 140,028,438	K93E	possibly damaging	Het
Pom121l2	G	C	13: 21,981,937	R126P	probably damaging	Het
Prkg1	C	T	19: 31,764,561	E88K	probably benign	Het
Psme4	A	T	11: 30,853,203	D15V	probably damaging	Het
Ptprf	A	G	4: 118,231,731	V625A	probably benign	Het
Rab27a	G	A	9: 73,085,008	S106N	probably damaging	Het
Rasa4	A	G	5: 136,100,948	T261A	probably benign	Het
Sardh	T	C	2: 27,228,257	D487G	probably benign	Het
Sec16a	A	G	2: 26,440,018	Y662H	probably benign	Het
Sema3d	T	A	5: 12,585,100	L711*	probably null	Het
Sept14	T	A	5: 129,696,117	Y152F	probably damaging	Het
Smc5	A	G	19: 23,242,640	L411P	probably damaging	Het
Spg7	T	A	8: 123,073,911	V39E	probably damaging	Het
Tas2r117	A	G	6: 132,802,854		probably benign	Het
Tle1	A	T	4: 72,122,450	I631N	probably damaging	Het
Tmed3	T	A	9: 89,699,790	S207C	probably damaging	Het
Tmem59l	G	A	8: 70,486,372	P51S	probably benign	Het
Trpc3	A	G	3: 36,624,393	Y848H	probably damaging	Het
Tsen2	T	C	6: 115,549,920	F66S	probably damaging	Het
Ttll5	T	A	12: 85,956,610	S216R	probably damaging	Het
Usp22	A	T	11: 61,157,216	V426E	probably damaging	Het
Vmn2r76	T	C	7: 86,225,906	N621S	probably damaging	Het
Wdr75	A	G	1: 45,817,379	T521A	probably damaging	Het
Wrnip1	T	A	13: 32,802,756	D173E	probably damaging	Het
Zfp317	G	A	9: 19,647,804	G438D	probably damaging	Het
Zscan10	T	A	17: 23,607,190	S109T	possibly damaging	Het

Other mutations in Greb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Greb1	APN	12	16711961	missense	probably damaging	1.00
IGL01316:Greb1	APN	12	16698586	missense	probably benign	0.04
IGL01464:Greb1	APN	12	16714826	missense	probably damaging	0.99
IGL01474:Greb1	APN	12	16684501	missense	probably benign
IGL01522:Greb1	APN	12	16701201	missense	probably damaging	1.00
IGL01824:Greb1	APN	12	16711716	nonsense	probably null
IGL01837:Greb1	APN	12	16684451	missense	probably benign	0.19
IGL01991:Greb1	APN	12	16699681	missense	probably damaging	1.00
IGL01996:Greb1	APN	12	16690845	missense	possibly damaging	0.70
IGL02213:Greb1	APN	12	16706232	missense	probably damaging	1.00
IGL02267:Greb1	APN	12	16717208	missense	probably benign	0.00
IGL02512:Greb1	APN	12	16692712	missense	possibly damaging	0.79
IGL02583:Greb1	APN	12	16706295	splice site	probably benign
IGL02613:Greb1	APN	12	16739888	critical splice donor site	probably null
IGL02648:Greb1	APN	12	16708682	missense	probably damaging	1.00
IGL02679:Greb1	APN	12	16708723	missense	probably damaging	1.00
begraben	UTSW	12	16684373	missense	possibly damaging	0.51
Eared	UTSW	12	16673863	missense	probably damaging	1.00
Humpback	UTSW	12	16701171	missense	probably damaging	1.00
pied_billed	UTSW	12	16724857	missense	possibly damaging	0.79
rednecked	UTSW	12	16682152	missense	probably damaging	0.99
G1patch:Greb1	UTSW	12	16688567	missense	probably damaging	1.00
IGL03048:Greb1	UTSW	12	16733331	missense	probably damaging	1.00
R0083:Greb1	UTSW	12	16696451	missense	probably benign
R0100:Greb1	UTSW	12	16680224	missense	probably benign	0.41
R0100:Greb1	UTSW	12	16680224	missense	probably benign	0.41
R0220:Greb1	UTSW	12	16682286	missense	probably damaging	1.00
R0245:Greb1	UTSW	12	16696456	missense	probably damaging	1.00
R0540:Greb1	UTSW	12	16682193	missense	probably damaging	1.00
R0547:Greb1	UTSW	12	16723411	missense	probably benign
R0563:Greb1	UTSW	12	16680267	missense	probably benign	0.23
R0607:Greb1	UTSW	12	16682193	missense	probably damaging	1.00
R0610:Greb1	UTSW	12	16696442	missense	probably benign
R0652:Greb1	UTSW	12	16696456	missense	probably damaging	1.00
R0659:Greb1	UTSW	12	16680212	missense	probably damaging	0.99
R0945:Greb1	UTSW	12	16673802	missense	probably benign	0.31
R1055:Greb1	UTSW	12	16682251	missense	probably damaging	0.98
R1445:Greb1	UTSW	12	16707851	missense	probably damaging	1.00
R1471:Greb1	UTSW	12	16711774	missense	probably damaging	0.97
R1503:Greb1	UTSW	12	16724819	nonsense	probably null
R1566:Greb1	UTSW	12	16711828	missense	possibly damaging	0.94
R1614:Greb1	UTSW	12	16701171	missense	probably damaging	1.00
R1623:Greb1	UTSW	12	16674770	missense	probably damaging	1.00
R1751:Greb1	UTSW	12	16723438	splice site	probably benign
R1778:Greb1	UTSW	12	16690894	missense	probably benign
R1842:Greb1	UTSW	12	16696243	missense	probably damaging	1.00
R2040:Greb1	UTSW	12	16702650	missense	probably damaging	1.00
R2153:Greb1	UTSW	12	16699532	missense	probably damaging	1.00
R2178:Greb1	UTSW	12	16696387	missense	probably damaging	1.00
R2194:Greb1	UTSW	12	16690908	missense	probably benign	0.08
R2248:Greb1	UTSW	12	16680378	missense	possibly damaging	0.90
R2474:Greb1	UTSW	12	16714953	missense	possibly damaging	0.93
R2509:Greb1	UTSW	12	16724922	missense	probably damaging	1.00
R2860:Greb1	UTSW	12	16711745	missense	probably benign	0.28
R2861:Greb1	UTSW	12	16711745	missense	probably benign	0.28
R2862:Greb1	UTSW	12	16711745	missense	probably benign	0.28
R2866:Greb1	UTSW	12	16699550	missense	probably damaging	1.00
R2890:Greb1	UTSW	12	16704478	missense	probably damaging	1.00
R3056:Greb1	UTSW	12	16688591	missense	probably damaging	0.96
R3863:Greb1	UTSW	12	16702420	missense	probably damaging	1.00
R3864:Greb1	UTSW	12	16702420	missense	probably damaging	1.00
R3956:Greb1	UTSW	12	16682299	missense	probably damaging	1.00
R4493:Greb1	UTSW	12	16698610	missense	probably benign	0.14
R4548:Greb1	UTSW	12	16699675	missense	probably damaging	1.00
R4683:Greb1	UTSW	12	16711773	missense	possibly damaging	0.75
R4739:Greb1	UTSW	12	16696328	missense	probably damaging	1.00
R4770:Greb1	UTSW	12	16681356	missense	probably benign	0.03
R4838:Greb1	UTSW	12	16684360	critical splice donor site	probably null
R4925:Greb1	UTSW	12	16681471	missense	probably damaging	1.00
R4982:Greb1	UTSW	12	16724761	missense	probably damaging	0.98
R5009:Greb1	UTSW	12	16724857	missense	possibly damaging	0.79
R5086:Greb1	UTSW	12	16708022	intron	probably benign
R5213:Greb1	UTSW	12	16714790	nonsense	probably null
R5310:Greb1	UTSW	12	16716759	missense	probably benign	0.09
R5353:Greb1	UTSW	12	16688566	nonsense	probably null
R5544:Greb1	UTSW	12	16673796	missense	probably damaging	1.00
R5605:Greb1	UTSW	12	16708726	missense	probably damaging	0.96
R5708:Greb1	UTSW	12	16673842	missense	probably benign	0.11
R5837:Greb1	UTSW	12	16688585	missense	probably damaging	1.00
R5890:Greb1	UTSW	12	16733421	missense	possibly damaging	0.90
R5938:Greb1	UTSW	12	16717258	missense	probably damaging	1.00
R6049:Greb1	UTSW	12	16681394	missense	probably damaging	0.99
R6093:Greb1	UTSW	12	16684486	missense	probably benign
R6120:Greb1	UTSW	12	16708621	missense	probably damaging	0.99
R6175:Greb1	UTSW	12	16674770	missense	probably damaging	1.00
R6247:Greb1	UTSW	12	16716675	missense	probably damaging	1.00
R6274:Greb1	UTSW	12	16735151	missense	probably damaging	0.97
R6376:Greb1	UTSW	12	16699579	missense	probably damaging	0.97
R6523:Greb1	UTSW	12	16684373	missense	possibly damaging	0.51
R6557:Greb1	UTSW	12	16710383	missense	probably benign	0.00
R6602:Greb1	UTSW	12	16709440	missense	probably benign	0.44
R6621:Greb1	UTSW	12	16692717	missense	probably damaging	1.00
R6645:Greb1	UTSW	12	16698579	missense	probably benign	0.07
R6725:Greb1	UTSW	12	16688567	missense	probably damaging	1.00
R6863:Greb1	UTSW	12	16684420	missense	probably damaging	1.00
R6914:Greb1	UTSW	12	16707902	missense	probably damaging	0.97
R6996:Greb1	UTSW	12	16723354	missense	probably benign	0.00
R7083:Greb1	UTSW	12	16723314	missense	probably benign
R7147:Greb1	UTSW	12	16733427	missense	probably damaging	1.00
R7238:Greb1	UTSW	12	16674672	missense	probably damaging	0.99
R7290:Greb1	UTSW	12	16711738	missense	probably damaging	1.00
R7358:Greb1	UTSW	12	16724881	missense	probably damaging	1.00
R7395:Greb1	UTSW	12	16709430	critical splice donor site	probably null
R7526:Greb1	UTSW	12	16716765	missense	probably benign	0.00
R7530:Greb1	UTSW	12	16717206	missense	probably benign	0.02
R7536:Greb1	UTSW	12	16682185	missense	probably damaging	1.00
R7643:Greb1	UTSW	12	16711996	missense	probably damaging	0.99
R7732:Greb1	UTSW	12	16673863	missense	probably damaging	1.00
R7740:Greb1	UTSW	12	16740121	start gained	probably benign
R7747:Greb1	UTSW	12	16674795	missense	probably benign	0.01
R7760:Greb1	UTSW	12	16723416	missense	probably benign
R7937:Greb1	UTSW	12	16716669	missense	probably damaging	0.99
R8043:Greb1	UTSW	12	16711789	missense	probably damaging	1.00
R8259:Greb1	UTSW	12	16724924	nonsense	probably null
R8553:Greb1	UTSW	12	16723327	missense	probably benign	0.00
R8559:Greb1	UTSW	12	16696435	missense	probably damaging	1.00
R8690:Greb1	UTSW	12	16696547	missense	probably benign	0.03
R8830:Greb1	UTSW	12	16688519	missense	probably benign	0.35
R8911:Greb1	UTSW	12	16690902	missense	possibly damaging	0.84
R8963:Greb1	UTSW	12	16724884	missense	probably damaging	1.00
R8986:Greb1	UTSW	12	16684456	missense	probably damaging	0.99
R9013:Greb1	UTSW	12	16739969	missense	probably damaging	1.00
R9279:Greb1	UTSW	12	16682152	missense	probably damaging	0.99
R9360:Greb1	UTSW	12	16740036	missense	probably damaging	1.00
R9563:Greb1	UTSW	12	16724823	missense	probably benign	0.06
R9616:Greb1	UTSW	12	16740037	missense	probably damaging	1.00
R9627:Greb1	UTSW	12	16706166	missense	probably damaging	1.00
R9731:Greb1	UTSW	12	16688597	missense	probably damaging	1.00
R9761:Greb1	UTSW	12	16701274	missense	probably benign	0.05
Z1176:Greb1	UTSW	12	16696756	missense	probably benign	0.00
Z1177:Greb1	UTSW	12	16702491	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCAGGGAAATAAACATGTGGCC -3'
(R):5'- TTAGCTTCCCCACTGAGACAC -3'

Sequencing Primer
(F):5'- ATAAACATGTGGCCTGTGATGC -3'
(R):5'- CTAGGCTGTGAGAGACAATCTTC -3'

Posted On

2018-08-01