Incidental Mutation 'R6750:Dld'
List |< first << previous [record 20 of 74] next >> last >|
ID530727
Institutional Source Beutler Lab
Gene Symbol Dld
Ensembl Gene ENSMUSG00000020664
Gene Namedihydrolipoamide dehydrogenase
Synonymsbranched chain alpha-keto acid dehydrogenase complex subunit E3, dihydrolipoyl dehydrogenase
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R6750 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location31331277-31351453 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31332214 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 498 (N498S)
Ref Sequence ENSEMBL: ENSMUSP00000106481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002979] [ENSMUST00000110857] [ENSMUST00000169088]
Predicted Effect probably benign
Transcript: ENSMUST00000002979
SMART Domains Protein: ENSMUSP00000002979
Gene: ENSMUSG00000002900

DomainStartEndE-ValueType
low complexity region 32 45 N/A INTRINSIC
LamNT 77 317 3.24e-96 SMART
EGF_Lam 319 380 1.34e-6 SMART
EGF_Lam 383 443 1.33e-10 SMART
EGF_Lam 446 503 2.89e-11 SMART
EGF_Lam 506 555 2.89e-11 SMART
EGF_Lam 558 602 3.4e-8 SMART
EGF_Lam 821 866 4.99e-15 SMART
EGF_Lam 869 912 2.38e-12 SMART
EGF_Lam 915 962 2.4e-8 SMART
EGF_Lam 965 1021 1.41e-5 SMART
EGF_Lam 1024 1073 4.81e-8 SMART
EGF_Lam 1076 1129 3.81e-11 SMART
EGF_Lam 1132 1177 5.61e-9 SMART
EGF_Lam 1180 1224 2.89e-11 SMART
coiled coil region 1329 1360 N/A INTRINSIC
low complexity region 1468 1480 N/A INTRINSIC
coiled coil region 1497 1551 N/A INTRINSIC
coiled coil region 1600 1826 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110857
AA Change: N498S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000106481
Gene: ENSMUSG00000020664
AA Change: N498S

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 42 370 2.3e-71 PFAM
Pfam:FAD_binding_2 43 83 2.5e-7 PFAM
Pfam:GIDA 43 111 1.7e-8 PFAM
Pfam:FAD_oxidored 43 135 4.3e-10 PFAM
Pfam:NAD_binding_8 46 100 1.4e-6 PFAM
Pfam:Pyr_redox 215 298 4.9e-17 PFAM
Pfam:Pyr_redox_dim 389 498 1.6e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169088
SMART Domains Protein: ENSMUSP00000132778
Gene: ENSMUSG00000002900

DomainStartEndE-ValueType
LamNT 29 269 3.24e-96 SMART
EGF_Lam 271 332 1.34e-6 SMART
EGF_Lam 335 395 1.33e-10 SMART
EGF_Lam 398 455 2.89e-11 SMART
EGF_Lam 458 507 2.89e-11 SMART
EGF_Lam 510 554 3.4e-8 SMART
EGF_Lam 773 818 4.99e-15 SMART
EGF_Lam 821 864 2.38e-12 SMART
EGF_Lam 867 914 2.4e-8 SMART
EGF_Lam 917 973 1.41e-5 SMART
EGF_Lam 976 1025 4.81e-8 SMART
EGF_Lam 1028 1081 3.81e-11 SMART
EGF_Lam 1084 1129 5.61e-9 SMART
EGF_Lam 1132 1176 2.89e-11 SMART
coiled coil region 1281 1312 N/A INTRINSIC
low complexity region 1420 1432 N/A INTRINSIC
coiled coil region 1449 1503 N/A INTRINSIC
coiled coil region 1552 1778 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218624
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: This gene encodes a member of the class-I pyridine nucleotide-disulfide oxidoreductase family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. In homodimeric form, the encoded protein functions as a dehydrogenase and is found in several multi-enzyme complexes that regulate energy metabolism. However, as a monomer, this protein can function as a protease. [provided by RefSeq, Jan 2014]
PHENOTYPE: Embryos homozygous for a targeted null mutation exhibit a developmental delay at 7.5 days postcoitum and are resorbed by 9.5 days postcoitum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,398 S477T possibly damaging Het
5430419D17Rik T A 7: 131,288,245 probably benign Het
Adal A T 2: 121,142,649 L62F probably damaging Het
Akap13 C T 7: 75,739,458 P2375S probably benign Het
Apob T A 12: 7,997,853 L931Q probably damaging Het
Arcn1 A G 9: 44,750,394 V391A possibly damaging Het
Ccdc162 A T 10: 41,561,226 I1729N possibly damaging Het
Cd24a T C 10: 43,582,725 L86P unknown Het
Churc1 C A 12: 76,775,631 H71Q probably damaging Het
Clcn3 A G 8: 60,914,775 L780P possibly damaging Het
Cldn17 C T 16: 88,506,307 G178E possibly damaging Het
Cmah A G 13: 24,464,252 Y345C probably damaging Het
Cntnap5b C T 1: 100,274,499 S357L probably damaging Het
Col6a6 A G 9: 105,783,680 I410T probably damaging Het
Crmp1 T C 5: 37,265,322 probably null Het
Csmd2 A C 4: 128,197,225 N186H possibly damaging Het
Cyp1a1 A T 9: 57,700,256 M56L probably benign Het
D2hgdh G C 1: 93,826,407 R56P probably benign Het
Dapk2 A G 9: 66,220,752 E104G probably damaging Het
Dyrk4 G T 6: 126,898,955 Q106K probably benign Het
Eif2b4 T C 5: 31,189,960 I333V probably damaging Het
F5 A G 1: 164,193,507 T1184A possibly damaging Het
Fbxl6 C T 15: 76,538,412 G102D probably damaging Het
Foxa1 C T 12: 57,542,610 G275R probably benign Het
Fryl A G 5: 73,022,232 I2944T probably damaging Het
Gm597 C A 1: 28,777,414 E512D probably damaging Het
Gna15 T C 10: 81,514,283 D95G probably benign Het
Greb1 T A 12: 16,688,583 M1460L probably benign Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Herc2 T C 7: 56,097,447 I444T probably damaging Het
Ifngr1 T A 10: 19,609,351 M366K probably benign Het
Krt27 C T 11: 99,348,980 E253K probably damaging Het
Micalcl C T 7: 112,381,839 T406I probably damaging Het
Mocs2 T G 13: 114,826,248 D156E probably damaging Het
Mprip A T 11: 59,696,131 K43N probably damaging Het
Myo5b A T 18: 74,617,035 T190S possibly damaging Het
Naa25 C T 5: 121,408,309 T86M probably damaging Het
Ncam1 T C 9: 49,567,339 D163G probably damaging Het
Nlrp4f A T 13: 65,181,654 Y908* probably null Het
Nlrp9b T A 7: 20,023,234 L132* probably null Het
Nrg1 A C 8: 31,818,096 S679A probably damaging Het
Olfr3 C A 2: 36,812,942 R50M possibly damaging Het
Olfr656 C T 7: 104,618,113 R145C probably damaging Het
Paqr9 A T 9: 95,560,997 T347S probably damaging Het
Pcdhb21 T C 18: 37,514,448 L210P probably damaging Het
Pdzd7 T G 19: 45,027,748 D978A probably benign Het
Pkd1l1 A T 11: 8,973,217 S17T unknown Het
Plcz1 T C 6: 140,028,438 K93E possibly damaging Het
Pom121l2 G C 13: 21,981,937 R126P probably damaging Het
Prkg1 C T 19: 31,764,561 E88K probably benign Het
Psme4 A T 11: 30,853,203 D15V probably damaging Het
Ptprf A G 4: 118,231,731 V625A probably benign Het
Rab27a G A 9: 73,085,008 S106N probably damaging Het
Rasa4 A G 5: 136,100,948 T261A probably benign Het
Sardh T C 2: 27,228,257 D487G probably benign Het
Sec16a A G 2: 26,440,018 Y662H probably benign Het
Sema3d T A 5: 12,585,100 L711* probably null Het
Sept14 T A 5: 129,696,117 Y152F probably damaging Het
Smc5 A G 19: 23,242,640 L411P probably damaging Het
Spg7 T A 8: 123,073,911 V39E probably damaging Het
Tas2r117 A G 6: 132,802,854 probably benign Het
Tle1 A T 4: 72,122,450 I631N probably damaging Het
Tmed3 T A 9: 89,699,790 S207C probably damaging Het
Tmem59l G A 8: 70,486,372 P51S probably benign Het
Trpc3 A G 3: 36,624,393 Y848H probably damaging Het
Tsen2 T C 6: 115,549,920 F66S probably damaging Het
Ttll5 T A 12: 85,956,610 S216R probably damaging Het
Usp22 A T 11: 61,157,216 V426E probably damaging Het
Vmn2r76 T C 7: 86,225,906 N621S probably damaging Het
Wdr75 A G 1: 45,817,379 T521A probably damaging Het
Wrnip1 T A 13: 32,802,756 D173E probably damaging Het
Zfp317 G A 9: 19,647,804 G438D probably damaging Het
Zscan10 T A 17: 23,607,190 S109T possibly damaging Het
Other mutations in Dld
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Dld APN 12 31335577 missense probably benign
IGL00656:Dld APN 12 31349595 critical splice donor site probably null
IGL00907:Dld APN 12 31332330 unclassified probably benign
IGL01870:Dld APN 12 31335467 missense possibly damaging 0.89
IGL02654:Dld APN 12 31333917 missense probably benign 0.19
IGL02666:Dld APN 12 31332409 missense probably null 0.00
PIT4544001:Dld UTSW 12 31335557 nonsense probably null
R0973:Dld UTSW 12 31334054 missense probably damaging 1.00
R1748:Dld UTSW 12 31334746 missense probably benign
R2225:Dld UTSW 12 31341449 missense probably benign 0.01
R4614:Dld UTSW 12 31333945 nonsense probably null
R5933:Dld UTSW 12 31333983 missense probably benign 0.00
R5966:Dld UTSW 12 31340326 missense probably damaging 1.00
R6088:Dld UTSW 12 31340989 missense probably benign
R6190:Dld UTSW 12 31344848 missense probably damaging 1.00
R6327:Dld UTSW 12 31332191 missense probably benign
R7149:Dld UTSW 12 31335590 missense probably benign
R7414:Dld UTSW 12 31335526 missense probably damaging 1.00
R7730:Dld UTSW 12 31340865 missense probably benign 0.00
X0065:Dld UTSW 12 31341389 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGCACTGGAACAAGATACGTG -3'
(R):5'- GCATTGGAATATGGTGCTTCC -3'

Sequencing Primer
(F):5'- GGTTATTCCATTCTGTTCAAACCTAC -3'
(R):5'- CCTGTGAAGATATAGCTCGAGTC -3'
Posted On2018-08-01