Incidental Mutation 'R6750:Churc1'
ID530729
Institutional Source Beutler Lab
Gene Symbol Churc1
Ensembl Gene ENSMUSG00000090258
Gene Namechurchill domain containing 1
Synonymschch, My015, 1700030P15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.542) question?
Stock #R6750 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location76765538-76783180 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 76775631 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 71 (H71Q)
Ref Sequence ENSEMBL: ENSMUSP00000047015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041262] [ENSMUST00000110399] [ENSMUST00000125842] [ENSMUST00000126408] [ENSMUST00000137826]
Predicted Effect probably damaging
Transcript: ENSMUST00000041262
AA Change: H71Q

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047015
Gene: ENSMUSG00000090258
AA Change: H71Q

DomainStartEndE-ValueType
Pfam:Churchill 1 112 2.6e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110399
SMART Domains Protein: ENSMUSP00000106029
Gene: ENSMUSG00000090258

DomainStartEndE-ValueType
Pfam:Churchill 1 69 2.8e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125842
SMART Domains Protein: ENSMUSP00000116906
Gene: ENSMUSG00000033373

DomainStartEndE-ValueType
Pfam:Churchill 1 65 2.4e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126408
Predicted Effect possibly damaging
Transcript: ENSMUST00000137826
AA Change: H71Q

PolyPhen 2 Score 0.739 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120713
Gene: ENSMUSG00000033373
AA Change: H71Q

DomainStartEndE-ValueType
Pfam:Churchill 1 92 1.9e-42 PFAM
Pfam:Prenyltrans 157 198 5.1e-16 PFAM
Pfam:Prenyltrans 206 249 2.8e-13 PFAM
Pfam:Prenyltrans 255 297 1e-14 PFAM
Pfam:Prenyltrans 302 346 1.6e-12 PFAM
Pfam:Prenyltrans 364 408 1.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152917
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,398 S477T possibly damaging Het
5430419D17Rik T A 7: 131,288,245 probably benign Het
Adal A T 2: 121,142,649 L62F probably damaging Het
Akap13 C T 7: 75,739,458 P2375S probably benign Het
Apob T A 12: 7,997,853 L931Q probably damaging Het
Arcn1 A G 9: 44,750,394 V391A possibly damaging Het
Ccdc162 A T 10: 41,561,226 I1729N possibly damaging Het
Cd24a T C 10: 43,582,725 L86P unknown Het
Clcn3 A G 8: 60,914,775 L780P possibly damaging Het
Cldn17 C T 16: 88,506,307 G178E possibly damaging Het
Cmah A G 13: 24,464,252 Y345C probably damaging Het
Cntnap5b C T 1: 100,274,499 S357L probably damaging Het
Col6a6 A G 9: 105,783,680 I410T probably damaging Het
Crmp1 T C 5: 37,265,322 probably null Het
Csmd2 A C 4: 128,197,225 N186H possibly damaging Het
Cyp1a1 A T 9: 57,700,256 M56L probably benign Het
D2hgdh G C 1: 93,826,407 R56P probably benign Het
Dapk2 A G 9: 66,220,752 E104G probably damaging Het
Dld T C 12: 31,332,214 N498S probably benign Het
Dyrk4 G T 6: 126,898,955 Q106K probably benign Het
Eif2b4 T C 5: 31,189,960 I333V probably damaging Het
F5 A G 1: 164,193,507 T1184A possibly damaging Het
Fbxl6 C T 15: 76,538,412 G102D probably damaging Het
Foxa1 C T 12: 57,542,610 G275R probably benign Het
Fryl A G 5: 73,022,232 I2944T probably damaging Het
Gm597 C A 1: 28,777,414 E512D probably damaging Het
Gna15 T C 10: 81,514,283 D95G probably benign Het
Greb1 T A 12: 16,688,583 M1460L probably benign Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Herc2 T C 7: 56,097,447 I444T probably damaging Het
Ifngr1 T A 10: 19,609,351 M366K probably benign Het
Krt27 C T 11: 99,348,980 E253K probably damaging Het
Micalcl C T 7: 112,381,839 T406I probably damaging Het
Mocs2 T G 13: 114,826,248 D156E probably damaging Het
Mprip A T 11: 59,696,131 K43N probably damaging Het
Myo5b A T 18: 74,617,035 T190S possibly damaging Het
Naa25 C T 5: 121,408,309 T86M probably damaging Het
Ncam1 T C 9: 49,567,339 D163G probably damaging Het
Nlrp4f A T 13: 65,181,654 Y908* probably null Het
Nlrp9b T A 7: 20,023,234 L132* probably null Het
Nrg1 A C 8: 31,818,096 S679A probably damaging Het
Olfr3 C A 2: 36,812,942 R50M possibly damaging Het
Olfr656 C T 7: 104,618,113 R145C probably damaging Het
Paqr9 A T 9: 95,560,997 T347S probably damaging Het
Pcdhb21 T C 18: 37,514,448 L210P probably damaging Het
Pdzd7 T G 19: 45,027,748 D978A probably benign Het
Pkd1l1 A T 11: 8,973,217 S17T unknown Het
Plcz1 T C 6: 140,028,438 K93E possibly damaging Het
Pom121l2 G C 13: 21,981,937 R126P probably damaging Het
Prkg1 C T 19: 31,764,561 E88K probably benign Het
Psme4 A T 11: 30,853,203 D15V probably damaging Het
Ptprf A G 4: 118,231,731 V625A probably benign Het
Rab27a G A 9: 73,085,008 S106N probably damaging Het
Rasa4 A G 5: 136,100,948 T261A probably benign Het
Sardh T C 2: 27,228,257 D487G probably benign Het
Sec16a A G 2: 26,440,018 Y662H probably benign Het
Sema3d T A 5: 12,585,100 L711* probably null Het
Sept14 T A 5: 129,696,117 Y152F probably damaging Het
Smc5 A G 19: 23,242,640 L411P probably damaging Het
Spg7 T A 8: 123,073,911 V39E probably damaging Het
Tas2r117 A G 6: 132,802,854 probably benign Het
Tle1 A T 4: 72,122,450 I631N probably damaging Het
Tmed3 T A 9: 89,699,790 S207C probably damaging Het
Tmem59l G A 8: 70,486,372 P51S probably benign Het
Trpc3 A G 3: 36,624,393 Y848H probably damaging Het
Tsen2 T C 6: 115,549,920 F66S probably damaging Het
Ttll5 T A 12: 85,956,610 S216R probably damaging Het
Usp22 A T 11: 61,157,216 V426E probably damaging Het
Vmn2r76 T C 7: 86,225,906 N621S probably damaging Het
Wdr75 A G 1: 45,817,379 T521A probably damaging Het
Wrnip1 T A 13: 32,802,756 D173E probably damaging Het
Zfp317 G A 9: 19,647,804 G438D probably damaging Het
Zscan10 T A 17: 23,607,190 S109T possibly damaging Het
Other mutations in Churc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
Winston UTSW 12 76775631 missense probably damaging 0.98
R1835:Churc1 UTSW 12 76773297 missense possibly damaging 0.70
R3765:Churc1 UTSW 12 76773283 nonsense probably null
R4809:Churc1 UTSW 12 76782897 missense probably damaging 1.00
R7728:Churc1 UTSW 12 76773278 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TTATATGTGCGCAGGGAGCC -3'
(R):5'- GTGAAGATGCACAGATCCACC -3'

Sequencing Primer
(F):5'- CCTCCAGGTCAGTGTTCTAATGG -3'
(R):5'- CACCTTTAAAGTTTCCCAGCATG -3'
Posted On2018-08-01