Incidental Mutation 'R6750:Wrnip1'
List |< first << previous [record 72 of 74] next >> last >|
ID530733
Institutional Source Beutler Lab
Gene Symbol Wrnip1
Ensembl Gene ENSMUSG00000021400
Gene NameWerner helicase interacting protein 1
Synonyms4833444L21Rik, WHIP
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6750 (G1)
Quality Score129.008
Status Validated
Chromosome13
Chromosomal Location32802038-32822609 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32802756 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 173 (D173E)
Ref Sequence ENSEMBL: ENSMUSP00000021832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021832] [ENSMUST00000057911]
Predicted Effect probably damaging
Transcript: ENSMUST00000021832
AA Change: D173E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021832
Gene: ENSMUSG00000021400
AA Change: D173E

DomainStartEndE-ValueType
ZnF_Rad18 17 40 4.76e-10 SMART
low complexity region 90 110 N/A INTRINSIC
low complexity region 135 156 N/A INTRINSIC
low complexity region 158 183 N/A INTRINSIC
AAA 255 375 9.86e-16 SMART
Pfam:AAA_assoc_2 413 506 6.4e-26 PFAM
Pfam:MgsA_C 507 659 3.9e-61 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000057911
AA Change: I32F
SMART Domains Protein: ENSMUSP00000050235
Gene: ENSMUSG00000042874
AA Change: I32F

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
low complexity region 37 46 N/A INTRINSIC
low complexity region 49 59 N/A INTRINSIC
transmembrane domain 93 115 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221066
Predicted Effect probably benign
Transcript: ENSMUST00000229351
Meta Mutation Damage Score 0.0707 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Werner's syndrome is a rare autosomal recessive disorder characterized by accelerated aging that is caused by defects in the Werner syndrome ATP-dependent helicase gene (WRN). The protein encoded by this gene interacts with the exonuclease-containing N-terminal portion of the Werner protein. This protein has a ubiquitin-binding zinc-finger domain in the N-terminus, an ATPase domain, and two leucine zipper motifs in the C-terminus. It has sequence similarity to replication factor C family proteins and is conserved from E. coli to human. This protein likely accumulates at sites of DNA damage by interacting with polyubiquinated proteins and also binds to DNA polymerase delta and increases the initiation frequency of DNA polymerase delta-mediated DNA synthesis. This protein also interacts with nucleoporins at nuclear pore complexes. Two transcript variants encoding different isoforms have been isolated for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,398 S477T possibly damaging Het
5430419D17Rik T A 7: 131,288,245 probably benign Het
Adal A T 2: 121,142,649 L62F probably damaging Het
Akap13 C T 7: 75,739,458 P2375S probably benign Het
Apob T A 12: 7,997,853 L931Q probably damaging Het
Arcn1 A G 9: 44,750,394 V391A possibly damaging Het
Ccdc162 A T 10: 41,561,226 I1729N possibly damaging Het
Cd24a T C 10: 43,582,725 L86P unknown Het
Churc1 C A 12: 76,775,631 H71Q probably damaging Het
Clcn3 A G 8: 60,914,775 L780P possibly damaging Het
Cldn17 C T 16: 88,506,307 G178E possibly damaging Het
Cmah A G 13: 24,464,252 Y345C probably damaging Het
Cntnap5b C T 1: 100,274,499 S357L probably damaging Het
Col6a6 A G 9: 105,783,680 I410T probably damaging Het
Crmp1 T C 5: 37,265,322 probably null Het
Csmd2 A C 4: 128,197,225 N186H possibly damaging Het
Cyp1a1 A T 9: 57,700,256 M56L probably benign Het
D2hgdh G C 1: 93,826,407 R56P probably benign Het
Dapk2 A G 9: 66,220,752 E104G probably damaging Het
Dld T C 12: 31,332,214 N498S probably benign Het
Dyrk4 G T 6: 126,898,955 Q106K probably benign Het
Eif2b4 T C 5: 31,189,960 I333V probably damaging Het
F5 A G 1: 164,193,507 T1184A possibly damaging Het
Fbxl6 C T 15: 76,538,412 G102D probably damaging Het
Foxa1 C T 12: 57,542,610 G275R probably benign Het
Fryl A G 5: 73,022,232 I2944T probably damaging Het
Gm597 C A 1: 28,777,414 E512D probably damaging Het
Gna15 T C 10: 81,514,283 D95G probably benign Het
Greb1 T A 12: 16,688,583 M1460L probably benign Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Herc2 T C 7: 56,097,447 I444T probably damaging Het
Ifngr1 T A 10: 19,609,351 M366K probably benign Het
Krt27 C T 11: 99,348,980 E253K probably damaging Het
Micalcl C T 7: 112,381,839 T406I probably damaging Het
Mocs2 T G 13: 114,826,248 D156E probably damaging Het
Mprip A T 11: 59,696,131 K43N probably damaging Het
Myo5b A T 18: 74,617,035 T190S possibly damaging Het
Naa25 C T 5: 121,408,309 T86M probably damaging Het
Ncam1 T C 9: 49,567,339 D163G probably damaging Het
Nlrp4f A T 13: 65,181,654 Y908* probably null Het
Nlrp9b T A 7: 20,023,234 L132* probably null Het
Nrg1 A C 8: 31,818,096 S679A probably damaging Het
Olfr3 C A 2: 36,812,942 R50M possibly damaging Het
Olfr656 C T 7: 104,618,113 R145C probably damaging Het
Paqr9 A T 9: 95,560,997 T347S probably damaging Het
Pcdhb21 T C 18: 37,514,448 L210P probably damaging Het
Pdzd7 T G 19: 45,027,748 D978A probably benign Het
Pkd1l1 A T 11: 8,973,217 S17T unknown Het
Plcz1 T C 6: 140,028,438 K93E possibly damaging Het
Pom121l2 G C 13: 21,981,937 R126P probably damaging Het
Prkg1 C T 19: 31,764,561 E88K probably benign Het
Psme4 A T 11: 30,853,203 D15V probably damaging Het
Ptprf A G 4: 118,231,731 V625A probably benign Het
Rab27a G A 9: 73,085,008 S106N probably damaging Het
Rasa4 A G 5: 136,100,948 T261A probably benign Het
Sardh T C 2: 27,228,257 D487G probably benign Het
Sec16a A G 2: 26,440,018 Y662H probably benign Het
Sema3d T A 5: 12,585,100 L711* probably null Het
Sept14 T A 5: 129,696,117 Y152F probably damaging Het
Smc5 A G 19: 23,242,640 L411P probably damaging Het
Spg7 T A 8: 123,073,911 V39E probably damaging Het
Tas2r117 A G 6: 132,802,854 probably benign Het
Tle1 A T 4: 72,122,450 I631N probably damaging Het
Tmed3 T A 9: 89,699,790 S207C probably damaging Het
Tmem59l G A 8: 70,486,372 P51S probably benign Het
Trpc3 A G 3: 36,624,393 Y848H probably damaging Het
Tsen2 T C 6: 115,549,920 F66S probably damaging Het
Ttll5 T A 12: 85,956,610 S216R probably damaging Het
Usp22 A T 11: 61,157,216 V426E probably damaging Het
Vmn2r76 T C 7: 86,225,906 N621S probably damaging Het
Wdr75 A G 1: 45,817,379 T521A probably damaging Het
Zfp317 G A 9: 19,647,804 G438D probably damaging Het
Zscan10 T A 17: 23,607,190 S109T possibly damaging Het
Other mutations in Wrnip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Wrnip1 APN 13 32816329 missense probably damaging 1.00
IGL02608:Wrnip1 APN 13 32806874 missense probably damaging 1.00
IGL02947:Wrnip1 APN 13 32822070 missense probably damaging 1.00
R0028:Wrnip1 UTSW 13 32820297 missense probably damaging 1.00
R0131:Wrnip1 UTSW 13 32806864 missense probably damaging 0.98
R0212:Wrnip1 UTSW 13 32821906 missense probably benign 0.45
R0545:Wrnip1 UTSW 13 32806813 missense probably damaging 1.00
R0638:Wrnip1 UTSW 13 32821090 missense possibly damaging 0.82
R1650:Wrnip1 UTSW 13 32805379 missense probably benign 0.02
R1894:Wrnip1 UTSW 13 32805336 critical splice acceptor site probably null
R2176:Wrnip1 UTSW 13 32820240 missense probably damaging 1.00
R2371:Wrnip1 UTSW 13 32802427 missense probably benign
R2475:Wrnip1 UTSW 13 32806958 missense probably benign 0.30
R3122:Wrnip1 UTSW 13 32802761 missense probably benign 0.06
R4247:Wrnip1 UTSW 13 32806883 missense probably damaging 1.00
R4604:Wrnip1 UTSW 13 32802347 missense probably damaging 1.00
R4978:Wrnip1 UTSW 13 32816312 missense probably damaging 1.00
R5109:Wrnip1 UTSW 13 32816336 missense probably damaging 1.00
R5148:Wrnip1 UTSW 13 32806856 missense probably damaging 1.00
R5929:Wrnip1 UTSW 13 32806966 missense probably damaging 1.00
R7137:Wrnip1 UTSW 13 32802749 missense probably benign 0.01
R7142:Wrnip1 UTSW 13 32802633 missense possibly damaging 0.51
R7378:Wrnip1 UTSW 13 32816281 missense probably benign 0.33
R7468:Wrnip1 UTSW 13 32816377 missense possibly damaging 0.80
R7470:Wrnip1 UTSW 13 32816327 nonsense probably null
R8049:Wrnip1 UTSW 13 32821977 missense probably benign
X0019:Wrnip1 UTSW 13 32806766 missense probably damaging 1.00
X0027:Wrnip1 UTSW 13 32802724 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATCAATTCGCACCTGGACCG -3'
(R):5'- TGTCTGGACGCATCTTGTCAG -3'

Sequencing Primer
(F):5'- AAGAGGCGTCGACTGTCG -3'
(R):5'- ACGCATCTTGTCAGCCAGC -3'
Posted On2018-08-01