Incidental Mutation 'R6751:Plxdc2'
ID530750
Institutional Source Beutler Lab
Gene Symbol Plxdc2
Ensembl Gene ENSMUSG00000026748
Gene Nameplexin domain containing 2
Synonyms5430431D22Rik, 1200007L24Rik, Tem7r
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6751 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location16356304-16755839 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 16548141 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 117 (I117F)
Ref Sequence ENSEMBL: ENSMUSP00000110350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028081] [ENSMUST00000114702] [ENSMUST00000114703]
Predicted Effect probably benign
Transcript: ENSMUST00000028081
AA Change: I117F

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000028081
Gene: ENSMUSG00000026748
AA Change: I117F

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
PSI 327 372 1.52e-3 SMART
low complexity region 390 401 N/A INTRINSIC
transmembrane domain 455 477 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114702
AA Change: I117F

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000110350
Gene: ENSMUSG00000026748
AA Change: I117F

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
PSI 327 372 1.52e-3 SMART
low complexity region 388 399 N/A INTRINSIC
transmembrane domain 453 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114703
SMART Domains Protein: ENSMUSP00000110351
Gene: ENSMUSG00000026748

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
PSI 278 323 1.52e-3 SMART
low complexity region 339 350 N/A INTRINSIC
transmembrane domain 404 426 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 95% (59/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a hypomorphic reporter allele are viable and behaviorally normal with no apparent abnormalities in the developing and mature nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,066,210 N387Y probably damaging Het
4932415D10Rik A G 10: 82,283,497 S4560P probably benign Het
Abhd17a T C 10: 80,586,587 E87G probably damaging Het
Aco1 T A 4: 40,188,330 probably null Het
Adcy6 T C 15: 98,596,205 N817S probably benign Het
Ak8 T A 2: 28,709,945 L63* probably null Het
Arhgef28 G A 13: 98,075,247 S76L probably damaging Het
Asap1 A G 15: 64,094,412 L891S possibly damaging Het
Cacng5 C A 11: 107,877,553 M209I probably benign Het
Casr T C 16: 36,515,588 I120V probably benign Het
Chd7 T C 4: 8,833,866 Y1207H probably damaging Het
Chrnb2 A T 3: 89,761,576 F144Y probably damaging Het
Cyp4a14 T A 4: 115,491,194 H362L probably damaging Het
Dym G A 18: 75,286,647 V630M probably damaging Het
Dyrk1b C A 7: 28,186,709 P619Q probably damaging Het
Dyx1c1 A G 9: 72,961,975 T156A probably benign Het
Eml5 T C 12: 98,865,400 D433G probably damaging Het
Fam58b T C 11: 78,751,124 Y180C probably damaging Het
Frem2 A T 3: 53,653,665 S1140R probably damaging Het
Gabra5 T C 7: 57,418,334 R255G probably damaging Het
Galnt17 T A 5: 131,081,590 I304F probably damaging Het
Gpc5 A G 14: 115,369,951 S322G probably benign Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Hmcn1 T A 1: 150,734,518 N1467Y probably damaging Het
Ifna6 T C 4: 88,827,750 L112P probably damaging Het
Ifrd1 C T 12: 40,203,914 probably null Het
Il17f A G 1: 20,779,489 M17T probably benign Het
Itga11 G A 9: 62,768,584 V892I probably benign Het
Nckap5l A G 15: 99,423,161 L1246P probably damaging Het
Nlrp4f A T 13: 65,194,429 H467Q probably damaging Het
Ntng2 A G 2: 29,228,043 V131A possibly damaging Het
Olfr550 G A 7: 102,578,499 M1I probably null Het
Olfr889 T G 9: 38,115,975 Y60D probably damaging Het
Olfr970 T A 9: 39,819,897 V86E probably benign Het
Olfr972 T C 9: 39,873,680 V135A probably benign Het
Osbpl8 T C 10: 111,275,013 Y459H possibly damaging Het
Pabpc1 A T 15: 36,597,534 V537D possibly damaging Het
Pde4b A T 4: 102,602,671 M583L probably damaging Het
Phlda1 T C 10: 111,506,694 V97A possibly damaging Het
Pik3cb G T 9: 99,094,521 H174Q probably benign Het
Psapl1 C A 5: 36,204,959 C298* probably null Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Rtkn2 T A 10: 68,041,453 F448I probably benign Het
Scn10a T C 9: 119,671,551 R221G probably damaging Het
Serpina3c A G 12: 104,151,500 L193P probably damaging Het
Sox12 T C 2: 152,396,758 Y314C probably damaging Het
Sptbn1 T C 11: 30,117,859 E1772G probably damaging Het
Supt6 A G 11: 78,208,949 V1570A probably benign Het
Synrg T C 11: 83,981,425 F125S probably damaging Het
Tenm4 A T 7: 96,845,712 I1116F possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tfap2d C A 1: 19,103,283 H10N possibly damaging Het
Trpm8 T C 1: 88,384,706 I1103T possibly damaging Het
Vmn1r158 C T 7: 22,789,881 C301Y probably damaging Het
Vmn2r56 T C 7: 12,694,792 I516V probably benign Het
Vmn2r71 G A 7: 85,619,887 probably null Het
Vnn3 C T 10: 23,869,625 R491C probably benign Het
Vps50 A G 6: 3,600,274 Y911C probably damaging Het
Wdr60 A T 12: 116,213,456 V842E possibly damaging Het
Zfp772 C T 7: 7,203,717 R325Q possibly damaging Het
Zranb3 T A 1: 127,959,819 H957L probably benign Het
Zscan20 G T 4: 128,585,875 T941K probably damaging Het
Zscan25 T A 5: 145,290,563 F346I probably damaging Het
Other mutations in Plxdc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Plxdc2 APN 2 16650139 missense probably damaging 1.00
IGL01700:Plxdc2 APN 2 16512115 missense probably benign 0.00
IGL02306:Plxdc2 APN 2 16660774 missense probably benign 0.06
IGL02555:Plxdc2 APN 2 16729341 missense probably benign 0.02
IGL02558:Plxdc2 APN 2 16669598 splice site probably benign
IGL03031:Plxdc2 APN 2 16650232 splice site probably null
IGL03114:Plxdc2 APN 2 16650124 missense probably damaging 1.00
R1024:Plxdc2 UTSW 2 16712106 missense probably benign 0.00
R1449:Plxdc2 UTSW 2 16660781 missense possibly damaging 0.82
R1840:Plxdc2 UTSW 2 16669856 missense probably benign 0.11
R2091:Plxdc2 UTSW 2 16713683 missense probably damaging 1.00
R2129:Plxdc2 UTSW 2 16512091 missense probably benign
R2192:Plxdc2 UTSW 2 16565336 missense probably damaging 0.99
R2287:Plxdc2 UTSW 2 16512190 missense probably benign 0.00
R2567:Plxdc2 UTSW 2 16712184 missense probably benign 0.00
R3964:Plxdc2 UTSW 2 16660840 missense probably damaging 0.98
R4167:Plxdc2 UTSW 2 16565385 missense probably damaging 0.99
R4496:Plxdc2 UTSW 2 16512229 missense probably damaging 1.00
R4876:Plxdc2 UTSW 2 16703318 missense probably damaging 1.00
R4891:Plxdc2 UTSW 2 16712146 missense probably benign
R5238:Plxdc2 UTSW 2 16650215 missense probably damaging 1.00
R5389:Plxdc2 UTSW 2 16650187 missense probably damaging 1.00
R5984:Plxdc2 UTSW 2 16660855 missense probably benign 0.28
R6675:Plxdc2 UTSW 2 16712121 missense probably benign
R7676:Plxdc2 UTSW 2 16712083 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AATCATTCACTAGTAGAGGCCCC -3'
(R):5'- ATGCTTTTCTCACTGTGGAGAAAAG -3'

Sequencing Primer
(F):5'- TGTGCACAAAGTTATAATTTGCTTC -3'
(R):5'- GTGTTGGAAAGTATCCCG -3'
Posted On2018-08-01