Mutagenetix > Incidental Mutations

Incidental Mutation 'R6751:Chd7'

530757

Institutional Source

Beutler Lab

Gene Symbol

Chd7

Ensembl Gene

ENSMUSG00000041235

Gene Name

chromodomain helicase DNA binding protein 7

Synonyms

A730019I05Rik, Cycn, Cyn, Dz, Edy, Flo, GENA 47, Gena 52, GENA 60, Lda, Mt, Obt, Todo, WBE1, Whi

MMRRC Submission

Accession Numbers

Genbank: NM_001081417; MGI: 2444748

Is this an essential gene?

Probably essential (E-score: 0.943) question?

Stock #

R6751 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

8690406-8867659 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 8833866 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 1207 (Y1207H)

Ref Sequence

ENSEMBL: ENSMUSP00000059079 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039267] [ENSMUST00000051558] [ENSMUST00000170391]

Predicted Effect

probably damaging
Transcript: ENSMUST00000039267
AA Change: Y1207H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000043903
Gene: ENSMUSG00000041235
AA Change: Y1207H

Domain	Start	End	E-Value	Type
low complexity region	11	28	N/A	INTRINSIC
low complexity region	48	59	N/A	INTRINSIC
low complexity region	107	129	N/A	INTRINSIC
low complexity region	152	178	N/A	INTRINSIC
low complexity region	194	206	N/A	INTRINSIC
low complexity region	385	400	N/A	INTRINSIC
low complexity region	491	504	N/A	INTRINSIC
low complexity region	512	535	N/A	INTRINSIC
low complexity region	585	595	N/A	INTRINSIC
low complexity region	632	696	N/A	INTRINSIC
low complexity region	721	733	N/A	INTRINSIC
low complexity region	735	748	N/A	INTRINSIC
low complexity region	759	768	N/A	INTRINSIC
CHROMO	789	854	2.54e-9	SMART
CHROMO	870	927	2.94e-5	SMART
low complexity region	928	939	N/A	INTRINSIC
DEXDc	954	1155	9.64e-38	SMART
HELICc	1310	1394	1.67e-23	SMART
Blast:DEXDc	1608	1653	8e-16	BLAST
low complexity region	1728	1739	N/A	INTRINSIC
internal_repeat_2	1774	1825	1.31e-5	PROSPERO
low complexity region	1831	1846	N/A	INTRINSIC
low complexity region	1898	1906	N/A	INTRINSIC
low complexity region	1929	1947	N/A	INTRINSIC
SANT	1952	2011	9.31e-1	SMART
internal_repeat_2	2079	2126	1.31e-5	PROSPERO
low complexity region	2173	2195	N/A	INTRINSIC
low complexity region	2218	2244	N/A	INTRINSIC
low complexity region	2387	2407	N/A	INTRINSIC
low complexity region	2437	2452	N/A	INTRINSIC
BRK	2553	2602	6.57e-23	SMART
BRK	2631	2675	3.77e-23	SMART
low complexity region	2715	2725	N/A	INTRINSIC
low complexity region	2746	2758	N/A	INTRINSIC
low complexity region	2769	2778	N/A	INTRINSIC
low complexity region	2785	2796	N/A	INTRINSIC
low complexity region	2810	2821	N/A	INTRINSIC
low complexity region	2897	2916	N/A	INTRINSIC
low complexity region	2967	2980	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000051558
AA Change: Y1207H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000059079
Gene: ENSMUSG00000041235
AA Change: Y1207H

Domain	Start	End	E-Value	Type
low complexity region	11	28	N/A	INTRINSIC
low complexity region	48	59	N/A	INTRINSIC
low complexity region	107	129	N/A	INTRINSIC
low complexity region	152	178	N/A	INTRINSIC
low complexity region	194	206	N/A	INTRINSIC
low complexity region	385	400	N/A	INTRINSIC
low complexity region	491	504	N/A	INTRINSIC
low complexity region	512	535	N/A	INTRINSIC
low complexity region	585	595	N/A	INTRINSIC
low complexity region	632	696	N/A	INTRINSIC
low complexity region	721	733	N/A	INTRINSIC
low complexity region	735	748	N/A	INTRINSIC
low complexity region	759	768	N/A	INTRINSIC
CHROMO	789	854	2.54e-9	SMART
CHROMO	870	927	2.94e-5	SMART
low complexity region	928	939	N/A	INTRINSIC
DEXDc	954	1155	9.64e-38	SMART
HELICc	1310	1394	1.67e-23	SMART
Blast:DEXDc	1608	1653	8e-16	BLAST
low complexity region	1728	1739	N/A	INTRINSIC
internal_repeat_2	1774	1825	1.31e-5	PROSPERO
low complexity region	1831	1846	N/A	INTRINSIC
low complexity region	1898	1906	N/A	INTRINSIC
low complexity region	1929	1947	N/A	INTRINSIC
SANT	1952	2011	9.31e-1	SMART
internal_repeat_2	2079	2126	1.31e-5	PROSPERO
low complexity region	2173	2195	N/A	INTRINSIC
low complexity region	2218	2244	N/A	INTRINSIC
low complexity region	2387	2407	N/A	INTRINSIC
low complexity region	2437	2452	N/A	INTRINSIC
BRK	2553	2602	6.57e-23	SMART
BRK	2631	2675	3.77e-23	SMART
low complexity region	2715	2725	N/A	INTRINSIC
low complexity region	2746	2758	N/A	INTRINSIC
low complexity region	2769	2778	N/A	INTRINSIC
low complexity region	2785	2796	N/A	INTRINSIC
low complexity region	2810	2821	N/A	INTRINSIC
low complexity region	2897	2916	N/A	INTRINSIC
low complexity region	2967	2980	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170391

SMART Domains

Protein: ENSMUSP00000127007
Gene: ENSMUSG00000041235

Domain	Start	End	E-Value	Type
low complexity region	11	28	N/A	INTRINSIC
low complexity region	48	59	N/A	INTRINSIC
low complexity region	107	129	N/A	INTRINSIC
low complexity region	152	178	N/A	INTRINSIC
low complexity region	194	206	N/A	INTRINSIC
low complexity region	385	400	N/A	INTRINSIC
low complexity region	491	504	N/A	INTRINSIC
low complexity region	512	535	N/A	INTRINSIC
BRK	586	630	3.77e-23	SMART
low complexity region	670	680	N/A	INTRINSIC
low complexity region	701	713	N/A	INTRINSIC
low complexity region	724	733	N/A	INTRINSIC
low complexity region	740	751	N/A	INTRINSIC
low complexity region	765	776	N/A	INTRINSIC
low complexity region	852	871	N/A	INTRINSIC
low complexity region	922	935	N/A	INTRINSIC

Meta Mutation Damage Score

0.8600

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.7%

Validation Efficiency

95% (59/62)

MGI Phenotype

FUNCTION: This gene encodes a protein containing two chromodomains and an ATP-binding helicase domain that functions as a regulator of transcription. Mutations in this gene result in an array of development defects, including inner ear problems. Mice defective for this gene exhibit many of the clinical features of the CHARGE syndrome caused by mutations in the homologous gene in human. [provided by RefSeq, Sep 2015]
PHENOTYPE: Heterozygotes for mutations of this gene exhibit a variety of combinations of hyperactivity, circling, head-bobbing, semicircular canal defects, hearing loss, reduced size, and tail-kink. [provided by MGI curators]

Allele List at MGI

All alleles(32) : Targeted, other(4) Gene trapped(19) Chemically induced(9)

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	T	3: 138,066,210	N387Y	probably damaging	Het
4932415D10Rik	A	G	10: 82,283,497	S4560P	probably benign	Het
Abhd17a	T	C	10: 80,586,587	E87G	probably damaging	Het
Aco1	T	A	4: 40,188,330		probably null	Het
Adcy6	T	C	15: 98,596,205	N817S	probably benign	Het
Ak8	T	A	2: 28,709,945	L63*	probably null	Het
Arhgef28	G	A	13: 98,075,247	S76L	probably damaging	Het
Asap1	A	G	15: 64,094,412	L891S	possibly damaging	Het
Cacng5	C	A	11: 107,877,553	M209I	probably benign	Het
Casr	T	C	16: 36,515,588	I120V	probably benign	Het
Chrnb2	A	T	3: 89,761,576	F144Y	probably damaging	Het
Cyp4a14	T	A	4: 115,491,194	H362L	probably damaging	Het
Dym	G	A	18: 75,286,647	V630M	probably damaging	Het
Dyrk1b	C	A	7: 28,186,709	P619Q	probably damaging	Het
Dyx1c1	A	G	9: 72,961,975	T156A	probably benign	Het
Eml5	T	C	12: 98,865,400	D433G	probably damaging	Het
Fam58b	T	C	11: 78,751,124	Y180C	probably damaging	Het
Frem2	A	T	3: 53,653,665	S1140R	probably damaging	Het
Gabra5	T	C	7: 57,418,334	R255G	probably damaging	Het
Galnt17	T	A	5: 131,081,590	I304F	probably damaging	Het
Gpc5	A	G	14: 115,369,951	S322G	probably benign	Het
Herc1	TCCC	TCC	9: 66,501,188		probably null	Het
Hmcn1	T	A	1: 150,734,518	N1467Y	probably damaging	Het
Ifna6	T	C	4: 88,827,750	L112P	probably damaging	Het
Ifrd1	C	T	12: 40,203,914		probably null	Het
Il17f	A	G	1: 20,779,489	M17T	probably benign	Het
Itga11	G	A	9: 62,768,584	V892I	probably benign	Het
Nckap5l	A	G	15: 99,423,161	L1246P	probably damaging	Het
Nlrp4f	A	T	13: 65,194,429	H467Q	probably damaging	Het
Ntng2	A	G	2: 29,228,043	V131A	possibly damaging	Het
Olfr550	G	A	7: 102,578,499	M1I	probably null	Het
Olfr889	T	G	9: 38,115,975	Y60D	probably damaging	Het
Olfr970	T	A	9: 39,819,897	V86E	probably benign	Het
Olfr972	T	C	9: 39,873,680	V135A	probably benign	Het
Osbpl8	T	C	10: 111,275,013	Y459H	possibly damaging	Het
Pabpc1	A	T	15: 36,597,534	V537D	possibly damaging	Het
Pde4b	A	T	4: 102,602,671	M583L	probably damaging	Het
Phlda1	T	C	10: 111,506,694	V97A	possibly damaging	Het
Pik3cb	G	T	9: 99,094,521	H174Q	probably benign	Het
Plxdc2	A	T	2: 16,548,141	I117F	probably benign	Het
Psapl1	C	A	5: 36,204,959	C298*	probably null	Het
Rsf1	G	GACGGCGGCT	7: 97,579,909		probably benign	Homo
Rtkn2	T	A	10: 68,041,453	F448I	probably benign	Het
Scn10a	T	C	9: 119,671,551	R221G	probably damaging	Het
Serpina3c	A	G	12: 104,151,500	L193P	probably damaging	Het
Sox12	T	C	2: 152,396,758	Y314C	probably damaging	Het
Sptbn1	T	C	11: 30,117,859	E1772G	probably damaging	Het
Supt6	A	G	11: 78,208,949	V1570A	probably benign	Het
Synrg	T	C	11: 83,981,425	F125S	probably damaging	Het
Tenm4	A	T	7: 96,845,712	I1116F	possibly damaging	Het
Tfap2a	T	A	13: 40,728,754	N25I	probably damaging	Het
Tfap2d	C	A	1: 19,103,283	H10N	possibly damaging	Het
Trpm8	T	C	1: 88,384,706	I1103T	possibly damaging	Het
Vmn1r158	C	T	7: 22,789,881	C301Y	probably damaging	Het
Vmn2r56	T	C	7: 12,694,792	I516V	probably benign	Het
Vmn2r71	G	A	7: 85,619,887		probably null	Het
Vnn3	C	T	10: 23,869,625	R491C	probably benign	Het
Vps50	A	G	6: 3,600,274	Y911C	probably damaging	Het
Wdr60	A	T	12: 116,213,456	V842E	possibly damaging	Het
Zfp772	C	T	7: 7,203,717	R325Q	possibly damaging	Het
Zranb3	T	A	1: 127,959,819	H957L	probably benign	Het
Zscan20	G	T	4: 128,585,875	T941K	probably damaging	Het
Zscan25	T	A	5: 145,290,563	F346I	probably damaging	Het

Other mutations in Chd7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Chd7	APN	4	8859106	missense	probably damaging	1.00
IGL00510:Chd7	APN	4	8801404	missense	probably damaging	1.00
IGL00741:Chd7	APN	4	8839454	missense	probably damaging	1.00
IGL00796:Chd7	APN	4	8847271	missense	possibly damaging	0.95
IGL00907:Chd7	APN	4	8840435	missense	probably damaging	0.98
IGL00930:Chd7	APN	4	8805181	missense	probably damaging	1.00
IGL01542:Chd7	APN	4	8859285	missense	possibly damaging	0.71
IGL01602:Chd7	APN	4	8833834	missense	probably damaging	1.00
IGL01605:Chd7	APN	4	8833834	missense	probably damaging	1.00
IGL01670:Chd7	APN	4	8827033	missense	probably damaging	0.98
IGL02434:Chd7	APN	4	8752145	missense	probably benign	0.00
IGL02531:Chd7	APN	4	8854134	missense	probably damaging	1.00
IGL02626:Chd7	APN	4	8826519	missense	probably damaging	1.00
IGL02961:Chd7	APN	4	8751542	missense	probably damaging	1.00
IGL02972:Chd7	APN	4	8855174	missense	probably benign	0.30
IGL03329:Chd7	APN	4	8841108	missense	probably damaging	1.00
Fili	UTSW	4	8839523	missense	probably damaging	1.00
D4043:Chd7	UTSW	4	8862650	missense	probably damaging	1.00
IGL02991:Chd7	UTSW	4	8828398	missense	possibly damaging	0.91
PIT4466001:Chd7	UTSW	4	8753101	missense	unknown
PIT4472001:Chd7	UTSW	4	8753101	missense	unknown
R0157:Chd7	UTSW	4	8833759	missense	probably damaging	1.00
R0179:Chd7	UTSW	4	8862516	missense	probably benign	0.22
R0240:Chd7	UTSW	4	8852670	unclassified	probably benign
R0388:Chd7	UTSW	4	8854560	missense	probably benign	0.27
R0462:Chd7	UTSW	4	8850821	missense	probably damaging	1.00
R0512:Chd7	UTSW	4	8805139	intron	probably benign
R0657:Chd7	UTSW	4	8753141	missense	probably damaging	1.00
R0799:Chd7	UTSW	4	8801310	intron	probably benign
R0885:Chd7	UTSW	4	8866432	missense	probably damaging	1.00
R1056:Chd7	UTSW	4	8822402	missense	possibly damaging	0.50
R1086:Chd7	UTSW	4	8866458	missense	probably benign	0.04
R1353:Chd7	UTSW	4	8839556	missense	probably damaging	0.99
R1466:Chd7	UTSW	4	8840561	splice site	probably null
R1466:Chd7	UTSW	4	8840561	splice site	probably null
R1605:Chd7	UTSW	4	8844675	missense	probably damaging	1.00
R1693:Chd7	UTSW	4	8864307	critical splice donor site	probably null
R1695:Chd7	UTSW	4	8833960	missense	probably damaging	1.00
R1938:Chd7	UTSW	4	8847200	missense	probably damaging	1.00
R1964:Chd7	UTSW	4	8865978	missense	probably damaging	0.96
R2020:Chd7	UTSW	4	8855226	missense	probably benign	0.00
R2134:Chd7	UTSW	4	8753147	missense	probably damaging	0.99
R2171:Chd7	UTSW	4	8752424	missense	probably damaging	1.00
R2271:Chd7	UTSW	4	8785532	missense	probably damaging	1.00
R2300:Chd7	UTSW	4	8855241	missense	probably benign	0.02
R2355:Chd7	UTSW	4	8801350	missense	possibly damaging	0.95
R3153:Chd7	UTSW	4	8855174	missense	probably benign	0.30
R3430:Chd7	UTSW	4	8844517	missense	probably damaging	0.99
R3746:Chd7	UTSW	4	8752537	missense	probably damaging	1.00
R4118:Chd7	UTSW	4	8865831	missense	probably damaging	1.00
R4119:Chd7	UTSW	4	8785658	intron	probably benign
R4332:Chd7	UTSW	4	8854143	missense	probably damaging	1.00
R4402:Chd7	UTSW	4	8866353	missense	possibly damaging	0.61
R4571:Chd7	UTSW	4	8866217	missense	probably benign	0.09
R4722:Chd7	UTSW	4	8822445	missense	probably damaging	1.00
R4821:Chd7	UTSW	4	8844706	missense	probably damaging	1.00
R4894:Chd7	UTSW	4	8838629	missense	probably damaging	0.99
R5205:Chd7	UTSW	4	8752509	missense	possibly damaging	0.60
R5344:Chd7	UTSW	4	8844417	missense	probably damaging	1.00
R5484:Chd7	UTSW	4	8828258	missense	probably damaging	1.00
R5578:Chd7	UTSW	4	8847149	missense	probably benign	0.09
R5583:Chd7	UTSW	4	8752473	missense	probably damaging	1.00
R5888:Chd7	UTSW	4	8866382	missense	probably damaging	0.98
R5905:Chd7	UTSW	4	8840553	missense	possibly damaging	0.91
R6091:Chd7	UTSW	4	8751875	missense	probably damaging	0.99
R6126:Chd7	UTSW	4	8826482	missense	probably damaging	1.00
R6399:Chd7	UTSW	4	8828274	missense	probably damaging	1.00
R6810:Chd7	UTSW	4	8839523	missense	probably damaging	1.00
R6868:Chd7	UTSW	4	8811501	splice site	probably null
R6952:Chd7	UTSW	4	8856797	missense	probably damaging	1.00
R6986:Chd7	UTSW	4	8859285	missense	possibly damaging	0.71
R6990:Chd7	UTSW	4	8844525	missense	probably benign	0.28
R7139:Chd7	UTSW	4	8865865	missense	probably benign	0.00
R7288:Chd7	UTSW	4	8847093	missense	possibly damaging	0.92
R7355:Chd7	UTSW	4	8752196	missense	unknown
R7452:Chd7	UTSW	4	8854731	missense	probably benign	0.03
R7471:Chd7	UTSW	4	8859197	missense	probably damaging	0.96
R7588:Chd7	UTSW	4	8864039	missense	probably damaging	1.00
R7711:Chd7	UTSW	4	8805234	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCAGGATGTTTTAACACGCAAG -3'
(R):5'- TGCTTTCAGAGAGCACTGGC -3'

Sequencing Primer
(F):5'- ACGCCTGAAAGAGGATGT -3'
(R):5'- TCAGCAACCACAGACGGGG -3'

Posted On

2018-08-01