Incidental Mutation 'R6751:Cyp4a14'
ID 530761
Institutional Source Beutler Lab
Gene Symbol Cyp4a14
Ensembl Gene ENSMUSG00000028715
Gene Name cytochrome P450, family 4, subfamily a, polypeptide 14
Synonyms
MMRRC Submission 044868-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R6751 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 115343397-115353339 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 115348391 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 362 (H362L)
Ref Sequence ENSEMBL: ENSMUSP00000030487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030487]
AlphaFold O35728
Predicted Effect probably damaging
Transcript: ENSMUST00000030487
AA Change: H362L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030487
Gene: ENSMUSG00000028715
AA Change: H362L

DomainStartEndE-ValueType
transmembrane domain 15 32 N/A INTRINSIC
Pfam:p450 51 503 5.4e-129 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124412
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 95% (59/62)
MGI Phenotype PHENOTYPE: Male mice homozygous for disruption of this gene display high blood pressure. Blood pressure is elevated in females as well to levels comparable to normotensive males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 137,771,971 (GRCm39) N387Y probably damaging Het
Abhd17a T C 10: 80,422,421 (GRCm39) E87G probably damaging Het
Aco1 T A 4: 40,188,330 (GRCm39) probably null Het
Adcy6 T C 15: 98,494,086 (GRCm39) N817S probably benign Het
Ak8 T A 2: 28,599,957 (GRCm39) L63* probably null Het
Arhgef28 G A 13: 98,211,755 (GRCm39) S76L probably damaging Het
Asap1 A G 15: 63,966,261 (GRCm39) L891S possibly damaging Het
Cacng5 C A 11: 107,768,379 (GRCm39) M209I probably benign Het
Casr T C 16: 36,335,950 (GRCm39) I120V probably benign Het
Ccnq T C 11: 78,641,950 (GRCm39) Y180C probably damaging Het
Chd7 T C 4: 8,833,866 (GRCm39) Y1207H probably damaging Het
Chrnb2 A T 3: 89,668,883 (GRCm39) F144Y probably damaging Het
Dnaaf4 A G 9: 72,869,257 (GRCm39) T156A probably benign Het
Dym G A 18: 75,419,718 (GRCm39) V630M probably damaging Het
Dync2i1 A T 12: 116,177,076 (GRCm39) V842E possibly damaging Het
Dyrk1b C A 7: 27,886,134 (GRCm39) P619Q probably damaging Het
Eml5 T C 12: 98,831,659 (GRCm39) D433G probably damaging Het
Frem2 A T 3: 53,561,086 (GRCm39) S1140R probably damaging Het
Gabra5 T C 7: 57,068,082 (GRCm39) R255G probably damaging Het
Galnt17 T A 5: 131,110,428 (GRCm39) I304F probably damaging Het
Gpc5 A G 14: 115,607,363 (GRCm39) S322G probably benign Het
Herc1 TCCC TCC 9: 66,408,470 (GRCm39) probably null Het
Hmcn1 T A 1: 150,610,269 (GRCm39) N1467Y probably damaging Het
Ifna6 T C 4: 88,745,987 (GRCm39) L112P probably damaging Het
Ifrd1 C T 12: 40,253,913 (GRCm39) probably null Het
Il17f A G 1: 20,849,713 (GRCm39) M17T probably benign Het
Itga11 G A 9: 62,675,866 (GRCm39) V892I probably benign Het
Nckap5l A G 15: 99,321,042 (GRCm39) L1246P probably damaging Het
Nlrp4f A T 13: 65,342,243 (GRCm39) H467Q probably damaging Het
Ntng2 A G 2: 29,118,055 (GRCm39) V131A possibly damaging Het
Or51r1 G A 7: 102,227,706 (GRCm39) M1I probably null Het
Or8b40 T G 9: 38,027,271 (GRCm39) Y60D probably damaging Het
Or8g37 T A 9: 39,731,193 (GRCm39) V86E probably benign Het
Or8g55 T C 9: 39,784,976 (GRCm39) V135A probably benign Het
Osbpl8 T C 10: 111,110,874 (GRCm39) Y459H possibly damaging Het
Pabpc1 A T 15: 36,597,778 (GRCm39) V537D possibly damaging Het
Pde4b A T 4: 102,459,868 (GRCm39) M583L probably damaging Het
Phlda1 T C 10: 111,342,555 (GRCm39) V97A possibly damaging Het
Pik3cb G T 9: 98,976,574 (GRCm39) H174Q probably benign Het
Plxdc2 A T 2: 16,552,952 (GRCm39) I117F probably benign Het
Psapl1 C A 5: 36,362,303 (GRCm39) C298* probably null Het
Rsf1 G GACGGCGGCT 7: 97,229,116 (GRCm39) probably benign Homo
Rtkn2 T A 10: 67,877,283 (GRCm39) F448I probably benign Het
Scn10a T C 9: 119,500,617 (GRCm39) R221G probably damaging Het
Serpina3c A G 12: 104,117,759 (GRCm39) L193P probably damaging Het
Sox12 T C 2: 152,238,678 (GRCm39) Y314C probably damaging Het
Spata31h1 A G 10: 82,119,331 (GRCm39) S4560P probably benign Het
Sptbn1 T C 11: 30,067,859 (GRCm39) E1772G probably damaging Het
Supt6 A G 11: 78,099,775 (GRCm39) V1570A probably benign Het
Synrg T C 11: 83,872,251 (GRCm39) F125S probably damaging Het
Tenm4 A T 7: 96,494,919 (GRCm39) I1116F possibly damaging Het
Tfap2a T A 13: 40,882,230 (GRCm39) N25I probably damaging Het
Tfap2d C A 1: 19,173,507 (GRCm39) H10N possibly damaging Het
Trpm8 T C 1: 88,312,428 (GRCm39) I1103T possibly damaging Het
Vmn1r158 C T 7: 22,489,306 (GRCm39) C301Y probably damaging Het
Vmn2r56 T C 7: 12,428,719 (GRCm39) I516V probably benign Het
Vmn2r71 G A 7: 85,269,095 (GRCm39) probably null Het
Vnn3 C T 10: 23,745,523 (GRCm39) R491C probably benign Het
Vps50 A G 6: 3,600,274 (GRCm39) Y911C probably damaging Het
Zfp772 C T 7: 7,206,716 (GRCm39) R325Q possibly damaging Het
Zranb3 T A 1: 127,887,556 (GRCm39) H957L probably benign Het
Zscan20 G T 4: 128,479,668 (GRCm39) T941K probably damaging Het
Zscan25 T A 5: 145,227,373 (GRCm39) F346I probably damaging Het
Other mutations in Cyp4a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Cyp4a14 APN 4 115,347,149 (GRCm39) splice site probably benign
IGL01539:Cyp4a14 APN 4 115,344,374 (GRCm39) missense possibly damaging 0.71
IGL01802:Cyp4a14 APN 4 115,352,134 (GRCm39) nonsense probably null
IGL02309:Cyp4a14 APN 4 115,348,829 (GRCm39) missense probably damaging 0.99
IGL02330:Cyp4a14 APN 4 115,352,224 (GRCm39) splice site probably benign
IGL03302:Cyp4a14 APN 4 115,348,575 (GRCm39) missense probably benign 0.00
R1037:Cyp4a14 UTSW 4 115,347,193 (GRCm39) missense probably damaging 1.00
R1236:Cyp4a14 UTSW 4 115,349,367 (GRCm39) missense probably benign 0.01
R2132:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2133:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2873:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R4015:Cyp4a14 UTSW 4 115,348,331 (GRCm39) missense probably damaging 1.00
R4925:Cyp4a14 UTSW 4 115,353,133 (GRCm39) missense possibly damaging 0.68
R5104:Cyp4a14 UTSW 4 115,353,126 (GRCm39) missense probably damaging 1.00
R5135:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R5150:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R5930:Cyp4a14 UTSW 4 115,348,607 (GRCm39) missense probably damaging 1.00
R5997:Cyp4a14 UTSW 4 115,353,297 (GRCm39) nonsense probably null
R6269:Cyp4a14 UTSW 4 115,348,328 (GRCm39) missense possibly damaging 0.87
R6354:Cyp4a14 UTSW 4 115,344,441 (GRCm39) missense probably damaging 1.00
R6377:Cyp4a14 UTSW 4 115,353,280 (GRCm39) missense probably benign 0.01
R6534:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R6563:Cyp4a14 UTSW 4 115,349,283 (GRCm39) missense probably benign 0.23
R7039:Cyp4a14 UTSW 4 115,348,278 (GRCm39) missense probably benign 0.23
R7125:Cyp4a14 UTSW 4 115,348,358 (GRCm39) missense probably damaging 1.00
R7379:Cyp4a14 UTSW 4 115,350,907 (GRCm39) splice site probably null
R7544:Cyp4a14 UTSW 4 115,348,283 (GRCm39) missense probably damaging 0.98
R7591:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R7740:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R7741:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R7753:Cyp4a14 UTSW 4 115,350,861 (GRCm39) missense probably damaging 1.00
R7789:Cyp4a14 UTSW 4 115,352,107 (GRCm39) missense probably benign 0.00
R8064:Cyp4a14 UTSW 4 115,352,155 (GRCm39) missense probably benign
R8311:Cyp4a14 UTSW 4 115,348,275 (GRCm39) missense probably damaging 1.00
R8458:Cyp4a14 UTSW 4 115,353,129 (GRCm39) missense probably damaging 1.00
R8868:Cyp4a14 UTSW 4 115,348,553 (GRCm39) missense probably damaging 1.00
R9039:Cyp4a14 UTSW 4 115,344,461 (GRCm39) missense probably damaging 0.97
R9632:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
R9710:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
Z1176:Cyp4a14 UTSW 4 115,347,214 (GRCm39) missense probably benign 0.01
Z1177:Cyp4a14 UTSW 4 115,348,650 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TCAAAGTACTTCAACACATGTGAGC -3'
(R):5'- TTGAGGGTCATGACACTACAG -3'

Sequencing Primer
(F):5'- CATGTGAGCATGTAGGTGACTG -3'
(R):5'- ACAGCCAGTGGAATTTCCTG -3'
Posted On 2018-08-01