Incidental Mutation 'R6751:Zscan20'
ID530762
Institutional Source Beutler Lab
Gene Symbol Zscan20
Ensembl Gene ENSMUSG00000061894
Gene Namezinc finger and SCAN domains 20
SynonymsZfp31
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R6751 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location128583539-128610098 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 128585875 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 941 (T941K)
Ref Sequence ENSEMBL: ENSMUSP00000095487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097877] [ENSMUST00000135309]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084276
Predicted Effect probably damaging
Transcript: ENSMUST00000097877
AA Change: T941K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095487
Gene: ENSMUSG00000061894
AA Change: T941K

DomainStartEndE-ValueType
SCAN 41 147 1.31e-54 SMART
low complexity region 275 284 N/A INTRINSIC
SANT 314 378 8.04e-1 SMART
SANT 475 539 4.85e-3 SMART
ZnF_C2H2 725 747 2.61e1 SMART
ZnF_C2H2 753 775 9.88e-5 SMART
ZnF_C2H2 781 803 1.12e-3 SMART
ZnF_C2H2 862 884 3.21e-4 SMART
ZnF_C2H2 890 912 1.04e-3 SMART
ZnF_C2H2 918 940 1.56e-2 SMART
ZnF_C2H2 946 968 2.84e-5 SMART
ZnF_C2H2 974 996 4.54e-4 SMART
ZnF_C2H2 1002 1024 1.47e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135309
SMART Domains Protein: ENSMUSP00000119338
Gene: ENSMUSG00000061894

DomainStartEndE-ValueType
SCAN 41 147 1.31e-54 SMART
low complexity region 279 293 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 95% (59/62)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,066,210 N387Y probably damaging Het
4932415D10Rik A G 10: 82,283,497 S4560P probably benign Het
Abhd17a T C 10: 80,586,587 E87G probably damaging Het
Aco1 T A 4: 40,188,330 probably null Het
Adcy6 T C 15: 98,596,205 N817S probably benign Het
Ak8 T A 2: 28,709,945 L63* probably null Het
Arhgef28 G A 13: 98,075,247 S76L probably damaging Het
Asap1 A G 15: 64,094,412 L891S possibly damaging Het
Cacng5 C A 11: 107,877,553 M209I probably benign Het
Casr T C 16: 36,515,588 I120V probably benign Het
Chd7 T C 4: 8,833,866 Y1207H probably damaging Het
Chrnb2 A T 3: 89,761,576 F144Y probably damaging Het
Cyp4a14 T A 4: 115,491,194 H362L probably damaging Het
Dym G A 18: 75,286,647 V630M probably damaging Het
Dyrk1b C A 7: 28,186,709 P619Q probably damaging Het
Dyx1c1 A G 9: 72,961,975 T156A probably benign Het
Eml5 T C 12: 98,865,400 D433G probably damaging Het
Fam58b T C 11: 78,751,124 Y180C probably damaging Het
Frem2 A T 3: 53,653,665 S1140R probably damaging Het
Gabra5 T C 7: 57,418,334 R255G probably damaging Het
Galnt17 T A 5: 131,081,590 I304F probably damaging Het
Gpc5 A G 14: 115,369,951 S322G probably benign Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Hmcn1 T A 1: 150,734,518 N1467Y probably damaging Het
Ifna6 T C 4: 88,827,750 L112P probably damaging Het
Ifrd1 C T 12: 40,203,914 probably null Het
Il17f A G 1: 20,779,489 M17T probably benign Het
Itga11 G A 9: 62,768,584 V892I probably benign Het
Nckap5l A G 15: 99,423,161 L1246P probably damaging Het
Nlrp4f A T 13: 65,194,429 H467Q probably damaging Het
Ntng2 A G 2: 29,228,043 V131A possibly damaging Het
Olfr550 G A 7: 102,578,499 M1I probably null Het
Olfr889 T G 9: 38,115,975 Y60D probably damaging Het
Olfr970 T A 9: 39,819,897 V86E probably benign Het
Olfr972 T C 9: 39,873,680 V135A probably benign Het
Osbpl8 T C 10: 111,275,013 Y459H possibly damaging Het
Pabpc1 A T 15: 36,597,534 V537D possibly damaging Het
Pde4b A T 4: 102,602,671 M583L probably damaging Het
Phlda1 T C 10: 111,506,694 V97A possibly damaging Het
Pik3cb G T 9: 99,094,521 H174Q probably benign Het
Plxdc2 A T 2: 16,548,141 I117F probably benign Het
Psapl1 C A 5: 36,204,959 C298* probably null Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Rtkn2 T A 10: 68,041,453 F448I probably benign Het
Scn10a T C 9: 119,671,551 R221G probably damaging Het
Serpina3c A G 12: 104,151,500 L193P probably damaging Het
Sox12 T C 2: 152,396,758 Y314C probably damaging Het
Sptbn1 T C 11: 30,117,859 E1772G probably damaging Het
Supt6 A G 11: 78,208,949 V1570A probably benign Het
Synrg T C 11: 83,981,425 F125S probably damaging Het
Tenm4 A T 7: 96,845,712 I1116F possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tfap2d C A 1: 19,103,283 H10N possibly damaging Het
Trpm8 T C 1: 88,384,706 I1103T possibly damaging Het
Vmn1r158 C T 7: 22,789,881 C301Y probably damaging Het
Vmn2r56 T C 7: 12,694,792 I516V probably benign Het
Vmn2r71 G A 7: 85,619,887 probably null Het
Vnn3 C T 10: 23,869,625 R491C probably benign Het
Vps50 A G 6: 3,600,274 Y911C probably damaging Het
Wdr60 A T 12: 116,213,456 V842E possibly damaging Het
Zfp772 C T 7: 7,203,717 R325Q possibly damaging Het
Zranb3 T A 1: 127,959,819 H957L probably benign Het
Zscan25 T A 5: 145,290,563 F346I probably damaging Het
Other mutations in Zscan20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Zscan20 APN 4 128586635 missense probably damaging 0.99
IGL01454:Zscan20 APN 4 128589541 missense probably benign 0.01
IGL01934:Zscan20 APN 4 128592484 missense possibly damaging 0.94
IGL02288:Zscan20 APN 4 128586643 missense probably damaging 1.00
IGL02336:Zscan20 APN 4 128585794 missense probably damaging 1.00
IGL02385:Zscan20 APN 4 128604599 missense possibly damaging 0.66
IGL02437:Zscan20 APN 4 128588417 missense probably damaging 1.00
IGL02450:Zscan20 APN 4 128586657 missense probably damaging 0.99
R0034:Zscan20 UTSW 4 128585662 missense probably damaging 0.96
R0034:Zscan20 UTSW 4 128585662 missense probably damaging 0.96
R0070:Zscan20 UTSW 4 128585882 missense possibly damaging 0.73
R0142:Zscan20 UTSW 4 128585837 missense probably benign 0.38
R0496:Zscan20 UTSW 4 128591889 missense probably benign 0.42
R0567:Zscan20 UTSW 4 128589450 critical splice donor site probably null
R1333:Zscan20 UTSW 4 128588096 missense possibly damaging 0.61
R1716:Zscan20 UTSW 4 128586541 missense probably damaging 0.96
R2302:Zscan20 UTSW 4 128588264 missense probably damaging 1.00
R3870:Zscan20 UTSW 4 128586425 missense probably damaging 1.00
R4611:Zscan20 UTSW 4 128588106 missense probably benign 0.00
R4884:Zscan20 UTSW 4 128588165 missense possibly damaging 0.56
R4972:Zscan20 UTSW 4 128592359 missense probably benign 0.39
R5033:Zscan20 UTSW 4 128586128 missense probably benign 0.01
R5160:Zscan20 UTSW 4 128592482 missense possibly damaging 0.69
R5182:Zscan20 UTSW 4 128586711 missense possibly damaging 0.71
R5214:Zscan20 UTSW 4 128588316 missense probably benign 0.00
R5345:Zscan20 UTSW 4 128588121 missense probably benign 0.04
R5863:Zscan20 UTSW 4 128586348 nonsense probably null
R6217:Zscan20 UTSW 4 128604534 missense probably damaging 1.00
R6597:Zscan20 UTSW 4 128585746 missense probably damaging 0.96
R6852:Zscan20 UTSW 4 128589722 missense probably damaging 1.00
R7172:Zscan20 UTSW 4 128585676 nonsense probably null
R7338:Zscan20 UTSW 4 128588150 missense probably benign
R7805:Zscan20 UTSW 4 128585806 missense probably damaging 1.00
R8063:Zscan20 UTSW 4 128586235 missense not run
Predicted Primers PCR Primer
(F):5'- TGTTGAAGTCTTTGCCGCATTC -3'
(R):5'- TCACCAAAGGATCCACAGTGG -3'

Sequencing Primer
(F):5'- GCACTTGTAGGGTTTCTCGCC -3'
(R):5'- GCGAGAAGCCGTATGAGTGTG -3'
Posted On2018-08-01