Incidental Mutation 'R6751:Olfr972'
ID530778
Institutional Source Beutler Lab
Gene Symbol Olfr972
Ensembl Gene ENSMUSG00000094449
Gene Nameolfactory receptor 972
SynonymsMOR171-17, GA_x6K02T2PVTD-33572803-33573747
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6751 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location39866422-39874651 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39873680 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 135 (V135A)
Ref Sequence ENSEMBL: ENSMUSP00000150498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079767] [ENSMUST00000215303] [ENSMUST00000216167]
Predicted Effect probably benign
Transcript: ENSMUST00000079767
AA Change: V135A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000078700
Gene: ENSMUSG00000094449
AA Change: V135A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 7.1e-54 PFAM
Pfam:7tm_1 41 290 2.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215303
AA Change: V135A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000216167
AA Change: V135A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,066,210 N387Y probably damaging Het
4932415D10Rik A G 10: 82,283,497 S4560P probably benign Het
Abhd17a T C 10: 80,586,587 E87G probably damaging Het
Aco1 T A 4: 40,188,330 probably null Het
Adcy6 T C 15: 98,596,205 N817S probably benign Het
Ak8 T A 2: 28,709,945 L63* probably null Het
Arhgef28 G A 13: 98,075,247 S76L probably damaging Het
Asap1 A G 15: 64,094,412 L891S possibly damaging Het
Cacng5 C A 11: 107,877,553 M209I probably benign Het
Casr T C 16: 36,515,588 I120V probably benign Het
Chd7 T C 4: 8,833,866 Y1207H probably damaging Het
Chrnb2 A T 3: 89,761,576 F144Y probably damaging Het
Cyp4a14 T A 4: 115,491,194 H362L probably damaging Het
Dym G A 18: 75,286,647 V630M probably damaging Het
Dyrk1b C A 7: 28,186,709 P619Q probably damaging Het
Dyx1c1 A G 9: 72,961,975 T156A probably benign Het
Eml5 T C 12: 98,865,400 D433G probably damaging Het
Fam58b T C 11: 78,751,124 Y180C probably damaging Het
Frem2 A T 3: 53,653,665 S1140R probably damaging Het
Gabra5 T C 7: 57,418,334 R255G probably damaging Het
Galnt17 T A 5: 131,081,590 I304F probably damaging Het
Gpc5 A G 14: 115,369,951 S322G probably benign Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Hmcn1 T A 1: 150,734,518 N1467Y probably damaging Het
Ifna6 T C 4: 88,827,750 L112P probably damaging Het
Ifrd1 C T 12: 40,203,914 probably null Het
Il17f A G 1: 20,779,489 M17T probably benign Het
Itga11 G A 9: 62,768,584 V892I probably benign Het
Nckap5l A G 15: 99,423,161 L1246P probably damaging Het
Nlrp4f A T 13: 65,194,429 H467Q probably damaging Het
Ntng2 A G 2: 29,228,043 V131A possibly damaging Het
Olfr550 G A 7: 102,578,499 M1I probably null Het
Olfr889 T G 9: 38,115,975 Y60D probably damaging Het
Olfr970 T A 9: 39,819,897 V86E probably benign Het
Osbpl8 T C 10: 111,275,013 Y459H possibly damaging Het
Pabpc1 A T 15: 36,597,534 V537D possibly damaging Het
Pde4b A T 4: 102,602,671 M583L probably damaging Het
Phlda1 T C 10: 111,506,694 V97A possibly damaging Het
Pik3cb G T 9: 99,094,521 H174Q probably benign Het
Plxdc2 A T 2: 16,548,141 I117F probably benign Het
Psapl1 C A 5: 36,204,959 C298* probably null Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Rtkn2 T A 10: 68,041,453 F448I probably benign Het
Scn10a T C 9: 119,671,551 R221G probably damaging Het
Serpina3c A G 12: 104,151,500 L193P probably damaging Het
Sox12 T C 2: 152,396,758 Y314C probably damaging Het
Sptbn1 T C 11: 30,117,859 E1772G probably damaging Het
Supt6 A G 11: 78,208,949 V1570A probably benign Het
Synrg T C 11: 83,981,425 F125S probably damaging Het
Tenm4 A T 7: 96,845,712 I1116F possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tfap2d C A 1: 19,103,283 H10N possibly damaging Het
Trpm8 T C 1: 88,384,706 I1103T possibly damaging Het
Vmn1r158 C T 7: 22,789,881 C301Y probably damaging Het
Vmn2r56 T C 7: 12,694,792 I516V probably benign Het
Vmn2r71 G A 7: 85,619,887 probably null Het
Vnn3 C T 10: 23,869,625 R491C probably benign Het
Vps50 A G 6: 3,600,274 Y911C probably damaging Het
Wdr60 A T 12: 116,213,456 V842E possibly damaging Het
Zfp772 C T 7: 7,203,717 R325Q possibly damaging Het
Zranb3 T A 1: 127,959,819 H957L probably benign Het
Zscan20 G T 4: 128,585,875 T941K probably damaging Het
Zscan25 T A 5: 145,290,563 F346I probably damaging Het
Other mutations in Olfr972
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01805:Olfr972 APN 9 39873779 missense probably damaging 1.00
IGL02008:Olfr972 APN 9 39873485 missense probably damaging 1.00
IGL02556:Olfr972 APN 9 39873610 missense possibly damaging 0.73
IGL02991:Olfr972 UTSW 9 39874066 missense probably benign 0.36
R0494:Olfr972 UTSW 9 39873402 missense probably damaging 1.00
R0725:Olfr972 UTSW 9 39873347 missense probably damaging 0.99
R1179:Olfr972 UTSW 9 39874075 missense possibly damaging 0.78
R1500:Olfr972 UTSW 9 39873411 missense probably benign 0.36
R1796:Olfr972 UTSW 9 39873971 missense probably benign 0.12
R1970:Olfr972 UTSW 9 39873938 missense probably damaging 1.00
R2018:Olfr972 UTSW 9 39874058 missense probably benign 0.35
R4065:Olfr972 UTSW 9 39873422 missense possibly damaging 0.86
R5254:Olfr972 UTSW 9 39873445 missense possibly damaging 0.94
R5799:Olfr972 UTSW 9 39874096 missense possibly damaging 0.78
R7525:Olfr972 UTSW 9 39874139 nonsense probably null
R7570:Olfr972 UTSW 9 39873455 missense possibly damaging 0.59
R7803:Olfr972 UTSW 9 39874082 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TGATCTCTGCCAGTCCAATG -3'
(R):5'- AGAGCTTAGAATTGTCAGAGTTGG -3'

Sequencing Primer
(F):5'- GCCAGTCCAATGTCATTATTCC -3'
(R):5'- TATTGAAAACACTGAAGCACAAAGC -3'
Posted On2018-08-01