Incidental Mutation 'R6751:4932415D10Rik'
ID530787
Institutional Source Beutler Lab
Gene Symbol 4932415D10Rik
Ensembl Gene ENSMUSG00000044581
Gene NameRIKEN cDNA 4932415D10 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R6751 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location82282116-82316582 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82283497 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 4560 (S4560P)
Ref Sequence ENSEMBL: ENSMUSP00000151425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171401] [ENSMUST00000217661]
Predicted Effect probably benign
Transcript: ENSMUST00000171401
SMART Domains Protein: ENSMUSP00000126178
Gene: ENSMUSG00000044581

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 241 263 N/A INTRINSIC
low complexity region 387 405 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217661
AA Change: S4560P

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 95% (59/62)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,066,210 N387Y probably damaging Het
Abhd17a T C 10: 80,586,587 E87G probably damaging Het
Aco1 T A 4: 40,188,330 probably null Het
Adcy6 T C 15: 98,596,205 N817S probably benign Het
Ak8 T A 2: 28,709,945 L63* probably null Het
Arhgef28 G A 13: 98,075,247 S76L probably damaging Het
Asap1 A G 15: 64,094,412 L891S possibly damaging Het
Cacng5 C A 11: 107,877,553 M209I probably benign Het
Casr T C 16: 36,515,588 I120V probably benign Het
Chd7 T C 4: 8,833,866 Y1207H probably damaging Het
Chrnb2 A T 3: 89,761,576 F144Y probably damaging Het
Cyp4a14 T A 4: 115,491,194 H362L probably damaging Het
Dym G A 18: 75,286,647 V630M probably damaging Het
Dyrk1b C A 7: 28,186,709 P619Q probably damaging Het
Dyx1c1 A G 9: 72,961,975 T156A probably benign Het
Eml5 T C 12: 98,865,400 D433G probably damaging Het
Fam58b T C 11: 78,751,124 Y180C probably damaging Het
Frem2 A T 3: 53,653,665 S1140R probably damaging Het
Gabra5 T C 7: 57,418,334 R255G probably damaging Het
Galnt17 T A 5: 131,081,590 I304F probably damaging Het
Gpc5 A G 14: 115,369,951 S322G probably benign Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Hmcn1 T A 1: 150,734,518 N1467Y probably damaging Het
Ifna6 T C 4: 88,827,750 L112P probably damaging Het
Ifrd1 C T 12: 40,203,914 probably null Het
Il17f A G 1: 20,779,489 M17T probably benign Het
Itga11 G A 9: 62,768,584 V892I probably benign Het
Nckap5l A G 15: 99,423,161 L1246P probably damaging Het
Nlrp4f A T 13: 65,194,429 H467Q probably damaging Het
Ntng2 A G 2: 29,228,043 V131A possibly damaging Het
Olfr550 G A 7: 102,578,499 M1I probably null Het
Olfr889 T G 9: 38,115,975 Y60D probably damaging Het
Olfr970 T A 9: 39,819,897 V86E probably benign Het
Olfr972 T C 9: 39,873,680 V135A probably benign Het
Osbpl8 T C 10: 111,275,013 Y459H possibly damaging Het
Pabpc1 A T 15: 36,597,534 V537D possibly damaging Het
Pde4b A T 4: 102,602,671 M583L probably damaging Het
Phlda1 T C 10: 111,506,694 V97A possibly damaging Het
Pik3cb G T 9: 99,094,521 H174Q probably benign Het
Plxdc2 A T 2: 16,548,141 I117F probably benign Het
Psapl1 C A 5: 36,204,959 C298* probably null Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Rtkn2 T A 10: 68,041,453 F448I probably benign Het
Scn10a T C 9: 119,671,551 R221G probably damaging Het
Serpina3c A G 12: 104,151,500 L193P probably damaging Het
Sox12 T C 2: 152,396,758 Y314C probably damaging Het
Sptbn1 T C 11: 30,117,859 E1772G probably damaging Het
Supt6 A G 11: 78,208,949 V1570A probably benign Het
Synrg T C 11: 83,981,425 F125S probably damaging Het
Tenm4 A T 7: 96,845,712 I1116F possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tfap2d C A 1: 19,103,283 H10N possibly damaging Het
Trpm8 T C 1: 88,384,706 I1103T possibly damaging Het
Vmn1r158 C T 7: 22,789,881 C301Y probably damaging Het
Vmn2r56 T C 7: 12,694,792 I516V probably benign Het
Vmn2r71 G A 7: 85,619,887 probably null Het
Vnn3 C T 10: 23,869,625 R491C probably benign Het
Vps50 A G 6: 3,600,274 Y911C probably damaging Het
Wdr60 A T 12: 116,213,456 V842E possibly damaging Het
Zfp772 C T 7: 7,203,717 R325Q possibly damaging Het
Zranb3 T A 1: 127,959,819 H957L probably benign Het
Zscan20 G T 4: 128,585,875 T941K probably damaging Het
Zscan25 T A 5: 145,290,563 F346I probably damaging Het
Other mutations in 4932415D10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:4932415D10Rik APN 10 82283752 missense probably benign 0.06
IGL01457:4932415D10Rik APN 10 82284734 missense probably damaging 1.00
IGL01540:4932415D10Rik APN 10 82284182 missense possibly damaging 0.87
IGL02693:4932415D10Rik APN 10 82285258 missense probably benign 0.06
IGL02867:4932415D10Rik APN 10 82283820 missense probably damaging 0.96
IGL02889:4932415D10Rik APN 10 82283820 missense probably damaging 0.96
IGL03080:4932415D10Rik APN 10 82283982 missense probably damaging 0.99
IGL03120:4932415D10Rik APN 10 82285035 missense possibly damaging 0.90
IGL03351:4932415D10Rik APN 10 82283567 utr 3 prime probably benign
FR4449:4932415D10Rik UTSW 10 82285469 frame shift probably null
FR4548:4932415D10Rik UTSW 10 82290996 small insertion probably benign
FR4737:4932415D10Rik UTSW 10 82285469 small deletion probably benign
PIT4480001:4932415D10Rik UTSW 10 82283752 missense probably benign 0.06
R0102:4932415D10Rik UTSW 10 82283556 missense probably damaging 1.00
R0312:4932415D10Rik UTSW 10 82284369 missense probably damaging 1.00
R1303:4932415D10Rik UTSW 10 82284556 missense possibly damaging 0.94
R2039:4932415D10Rik UTSW 10 82284676 missense probably damaging 1.00
R2356:4932415D10Rik UTSW 10 82283955 missense possibly damaging 0.94
R4740:4932415D10Rik UTSW 10 82283647 missense possibly damaging 0.50
R4857:4932415D10Rik UTSW 10 82283848 missense possibly damaging 0.61
R5017:4932415D10Rik UTSW 10 82296676 missense unknown
R5095:4932415D10Rik UTSW 10 82283667 missense probably damaging 1.00
R5209:4932415D10Rik UTSW 10 82283818 missense possibly damaging 0.84
R5388:4932415D10Rik UTSW 10 82283727 missense probably damaging 0.99
R5642:4932415D10Rik UTSW 10 82284483 missense probably damaging 1.00
R5646:4932415D10Rik UTSW 10 82283776 missense probably damaging 0.99
R6188:4932415D10Rik UTSW 10 82285257 missense probably damaging 0.96
R6215:4932415D10Rik UTSW 10 82291112 missense probably benign 0.07
R6252:4932415D10Rik UTSW 10 82283754 missense probably benign 0.30
R6275:4932415D10Rik UTSW 10 82285368 missense probably damaging 1.00
R6303:4932415D10Rik UTSW 10 82290368 missense possibly damaging 0.79
R6304:4932415D10Rik UTSW 10 82290368 missense possibly damaging 0.79
R6313:4932415D10Rik UTSW 10 82293636 missense probably benign 0.00
R6323:4932415D10Rik UTSW 10 82283082 missense probably benign 0.27
R6374:4932415D10Rik UTSW 10 82288897 unclassified probably benign
R6407:4932415D10Rik UTSW 10 82293811 missense probably benign 0.16
R6468:4932415D10Rik UTSW 10 82295316 missense probably benign 0.01
R6490:4932415D10Rik UTSW 10 82289304 missense possibly damaging 0.90
R6605:4932415D10Rik UTSW 10 82296037 missense probably benign 0.27
R6614:4932415D10Rik UTSW 10 82291648 missense probably benign 0.31
R6626:4932415D10Rik UTSW 10 82292833 missense probably benign 0.03
R6630:4932415D10Rik UTSW 10 82287072 missense possibly damaging 0.81
R6646:4932415D10Rik UTSW 10 82296830 missense unknown
R6723:4932415D10Rik UTSW 10 82289823 missense possibly damaging 0.50
R6850:4932415D10Rik UTSW 10 82293054 missense possibly damaging 0.68
R6944:4932415D10Rik UTSW 10 82296222 missense probably benign 0.03
R6957:4932415D10Rik UTSW 10 82293786 missense probably benign 0.03
R6988:4932415D10Rik UTSW 10 82291899 missense possibly damaging 0.79
R7069:4932415D10Rik UTSW 10 82289943 missense probably damaging 0.99
R7164:4932415D10Rik UTSW 10 82286229 missense probably damaging 1.00
R7175:4932415D10Rik UTSW 10 82286749 missense probably damaging 1.00
R7201:4932415D10Rik UTSW 10 82291627 missense probably benign 0.03
R7203:4932415D10Rik UTSW 10 82293414 missense probably benign 0.00
R7205:4932415D10Rik UTSW 10 82289327 missense probably benign 0.35
R7241:4932415D10Rik UTSW 10 82287042 missense probably benign 0.01
R7283:4932415D10Rik UTSW 10 82291297 missense possibly damaging 0.90
R7305:4932415D10Rik UTSW 10 82285119 missense probably benign 0.06
R7358:4932415D10Rik UTSW 10 82292013 missense possibly damaging 0.79
R7360:4932415D10Rik UTSW 10 82296507 missense unknown
R7362:4932415D10Rik UTSW 10 82292997 missense possibly damaging 0.79
R7385:4932415D10Rik UTSW 10 82287737 missense probably benign 0.03
R7385:4932415D10Rik UTSW 10 82287895 missense probably benign 0.05
R7472:4932415D10Rik UTSW 10 82283587 missense probably benign 0.03
R7493:4932415D10Rik UTSW 10 82288964 nonsense probably null
R7493:4932415D10Rik UTSW 10 82316430 missense unknown
R7498:4932415D10Rik UTSW 10 82291279 missense probably benign 0.03
R7512:4932415D10Rik UTSW 10 82292635 missense probably benign 0.31
R7560:4932415D10Rik UTSW 10 82284615 missense probably damaging 1.00
R7591:4932415D10Rik UTSW 10 82292212 missense probably benign 0.16
R7636:4932415D10Rik UTSW 10 82295139 missense probably benign 0.01
R7640:4932415D10Rik UTSW 10 82294656 missense probably damaging 0.99
R7709:4932415D10Rik UTSW 10 82290532 missense possibly damaging 0.81
R7790:4932415D10Rik UTSW 10 82287495 missense probably benign 0.06
RF017:4932415D10Rik UTSW 10 82290992 small insertion probably benign
RF055:4932415D10Rik UTSW 10 82290993 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TCTTGACTGGATACGTCATCAC -3'
(R):5'- CTAAGGCAGGCATTCCAAGC -3'

Sequencing Primer
(F):5'- GGATACGTCATCACTACAACTTTTCG -3'
(R):5'- GCAGGCATTCCAAGCAGCAC -3'
Posted On2018-08-01