Incidental Mutation 'R6751:Supt6'
ID530791
Institutional Source Beutler Lab
Gene Symbol Supt6
Ensembl Gene ENSMUSG00000002052
Gene Namesuppressor of Ty 6
SynonymsSPT6, Supt6h, 5131400N11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6751 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location78206746-78245987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78208949 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1570 (V1570A)
Ref Sequence ENSEMBL: ENSMUSP00000002121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002121] [ENSMUST00000060539] [ENSMUST00000078099] [ENSMUST00000108317]
Predicted Effect probably benign
Transcript: ENSMUST00000002121
AA Change: V1570A

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000002121
Gene: ENSMUSG00000002052
AA Change: V1570A

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Pfam:SPT6_acidic 37 127 8.8e-19 PFAM
low complexity region 146 164 N/A INTRINSIC
low complexity region 170 189 N/A INTRINSIC
low complexity region 192 203 N/A INTRINSIC
low complexity region 220 250 N/A INTRINSIC
low complexity region 252 267 N/A INTRINSIC
Pfam:HTH_44 305 432 1.3e-28 PFAM
low complexity region 494 509 N/A INTRINSIC
YqgFc 779 894 4.27e-21 SMART
Pfam:HHH_7 935 1038 3.1e-55 PFAM
Pfam:HHH_3 966 1036 5.2e-10 PFAM
Pfam:DLD 1051 1159 6.8e-39 PFAM
S1 1221 1282 2.8e-3 SMART
SH2 1332 1421 4.12e-11 SMART
low complexity region 1441 1454 N/A INTRINSIC
Blast:SH2 1455 1517 9e-19 BLAST
low complexity region 1586 1599 N/A INTRINSIC
low complexity region 1639 1664 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000060539
SMART Domains Protein: ENSMUSP00000050319
Gene: ENSMUSG00000044122

DomainStartEndE-ValueType
low complexity region 42 53 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078099
SMART Domains Protein: ENSMUSP00000086022
Gene: ENSMUSG00000044122

DomainStartEndE-ValueType
coiled coil region 92 121 N/A INTRINSIC
low complexity region 148 161 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108314
Predicted Effect probably benign
Transcript: ENSMUST00000108317
SMART Domains Protein: ENSMUSP00000103953
Gene: ENSMUSG00000044122

DomainStartEndE-ValueType
Blast:PA2c 33 99 2e-12 BLAST
SCOP:d1poc__ 55 102 5e-4 SMART
coiled coil region 179 208 N/A INTRINSIC
low complexity region 235 248 N/A INTRINSIC
low complexity region 285 299 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124772
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 95% (59/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality during pre-implantation development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,066,210 N387Y probably damaging Het
4932415D10Rik A G 10: 82,283,497 S4560P probably benign Het
Abhd17a T C 10: 80,586,587 E87G probably damaging Het
Aco1 T A 4: 40,188,330 probably null Het
Adcy6 T C 15: 98,596,205 N817S probably benign Het
Ak8 T A 2: 28,709,945 L63* probably null Het
Arhgef28 G A 13: 98,075,247 S76L probably damaging Het
Asap1 A G 15: 64,094,412 L891S possibly damaging Het
Cacng5 C A 11: 107,877,553 M209I probably benign Het
Casr T C 16: 36,515,588 I120V probably benign Het
Chd7 T C 4: 8,833,866 Y1207H probably damaging Het
Chrnb2 A T 3: 89,761,576 F144Y probably damaging Het
Cyp4a14 T A 4: 115,491,194 H362L probably damaging Het
Dym G A 18: 75,286,647 V630M probably damaging Het
Dyrk1b C A 7: 28,186,709 P619Q probably damaging Het
Dyx1c1 A G 9: 72,961,975 T156A probably benign Het
Eml5 T C 12: 98,865,400 D433G probably damaging Het
Fam58b T C 11: 78,751,124 Y180C probably damaging Het
Frem2 A T 3: 53,653,665 S1140R probably damaging Het
Gabra5 T C 7: 57,418,334 R255G probably damaging Het
Galnt17 T A 5: 131,081,590 I304F probably damaging Het
Gpc5 A G 14: 115,369,951 S322G probably benign Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Hmcn1 T A 1: 150,734,518 N1467Y probably damaging Het
Ifna6 T C 4: 88,827,750 L112P probably damaging Het
Ifrd1 C T 12: 40,203,914 probably null Het
Il17f A G 1: 20,779,489 M17T probably benign Het
Itga11 G A 9: 62,768,584 V892I probably benign Het
Nckap5l A G 15: 99,423,161 L1246P probably damaging Het
Nlrp4f A T 13: 65,194,429 H467Q probably damaging Het
Ntng2 A G 2: 29,228,043 V131A possibly damaging Het
Olfr550 G A 7: 102,578,499 M1I probably null Het
Olfr889 T G 9: 38,115,975 Y60D probably damaging Het
Olfr970 T A 9: 39,819,897 V86E probably benign Het
Olfr972 T C 9: 39,873,680 V135A probably benign Het
Osbpl8 T C 10: 111,275,013 Y459H possibly damaging Het
Pabpc1 A T 15: 36,597,534 V537D possibly damaging Het
Pde4b A T 4: 102,602,671 M583L probably damaging Het
Phlda1 T C 10: 111,506,694 V97A possibly damaging Het
Pik3cb G T 9: 99,094,521 H174Q probably benign Het
Plxdc2 A T 2: 16,548,141 I117F probably benign Het
Psapl1 C A 5: 36,204,959 C298* probably null Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Rtkn2 T A 10: 68,041,453 F448I probably benign Het
Scn10a T C 9: 119,671,551 R221G probably damaging Het
Serpina3c A G 12: 104,151,500 L193P probably damaging Het
Sox12 T C 2: 152,396,758 Y314C probably damaging Het
Sptbn1 T C 11: 30,117,859 E1772G probably damaging Het
Synrg T C 11: 83,981,425 F125S probably damaging Het
Tenm4 A T 7: 96,845,712 I1116F possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tfap2d C A 1: 19,103,283 H10N possibly damaging Het
Trpm8 T C 1: 88,384,706 I1103T possibly damaging Het
Vmn1r158 C T 7: 22,789,881 C301Y probably damaging Het
Vmn2r56 T C 7: 12,694,792 I516V probably benign Het
Vmn2r71 G A 7: 85,619,887 probably null Het
Vnn3 C T 10: 23,869,625 R491C probably benign Het
Vps50 A G 6: 3,600,274 Y911C probably damaging Het
Wdr60 A T 12: 116,213,456 V842E possibly damaging Het
Zfp772 C T 7: 7,203,717 R325Q possibly damaging Het
Zranb3 T A 1: 127,959,819 H957L probably benign Het
Zscan20 G T 4: 128,585,875 T941K probably damaging Het
Zscan25 T A 5: 145,290,563 F346I probably damaging Het
Other mutations in Supt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Supt6 APN 11 78231181 missense possibly damaging 0.94
IGL01457:Supt6 APN 11 78221143 missense probably damaging 1.00
IGL01608:Supt6 APN 11 78225483 missense probably damaging 1.00
IGL01739:Supt6 APN 11 78222187 missense probably damaging 1.00
IGL01765:Supt6 APN 11 78222159 missense probably benign 0.09
IGL01894:Supt6 APN 11 78222838 missense probably benign 0.00
IGL01952:Supt6 APN 11 78225760 missense probably benign 0.01
IGL02067:Supt6 APN 11 78231157 missense probably benign 0.01
IGL02244:Supt6 APN 11 78232797 missense possibly damaging 0.92
IGL02267:Supt6 APN 11 78226204 missense possibly damaging 0.72
IGL02379:Supt6 APN 11 78225369 missense possibly damaging 0.75
IGL02541:Supt6 APN 11 78226918 missense probably damaging 0.99
IGL02635:Supt6 APN 11 78212739 missense probably damaging 1.00
IGL03347:Supt6 APN 11 78232185 missense possibly damaging 0.71
IGL02980:Supt6 UTSW 11 78225722 missense probably damaging 1.00
IGL02991:Supt6 UTSW 11 78225353 missense probably damaging 1.00
R0145:Supt6 UTSW 11 78208236 missense probably benign 0.22
R0371:Supt6 UTSW 11 78223157 missense probably benign 0.00
R0452:Supt6 UTSW 11 78227003 missense probably damaging 1.00
R0464:Supt6 UTSW 11 78216338 missense probably benign 0.33
R0616:Supt6 UTSW 11 78209495 missense probably damaging 1.00
R0653:Supt6 UTSW 11 78226015 missense probably benign 0.01
R0788:Supt6 UTSW 11 78207772 unclassified probably benign
R1103:Supt6 UTSW 11 78225473 missense possibly damaging 0.59
R1282:Supt6 UTSW 11 78228768 missense possibly damaging 0.83
R1460:Supt6 UTSW 11 78222198 missense possibly damaging 0.93
R1508:Supt6 UTSW 11 78216203 critical splice donor site probably null
R1850:Supt6 UTSW 11 78219877 splice site probably benign
R1854:Supt6 UTSW 11 78232540 missense possibly damaging 0.51
R1855:Supt6 UTSW 11 78232540 missense possibly damaging 0.51
R2054:Supt6 UTSW 11 78224361 splice site probably benign
R2098:Supt6 UTSW 11 78213261 splice site probably null
R2146:Supt6 UTSW 11 78230932 missense probably damaging 1.00
R2167:Supt6 UTSW 11 78208167 missense possibly damaging 0.94
R4621:Supt6 UTSW 11 78212746 missense possibly damaging 0.65
R4734:Supt6 UTSW 11 78224683 missense probably benign 0.01
R4825:Supt6 UTSW 11 78208134 missense possibly damaging 0.84
R5575:Supt6 UTSW 11 78228961 missense probably damaging 1.00
R5789:Supt6 UTSW 11 78233586 missense unknown
R5889:Supt6 UTSW 11 78212748 missense probably damaging 0.98
R6296:Supt6 UTSW 11 78226059 missense possibly damaging 0.48
R6297:Supt6 UTSW 11 78226059 missense possibly damaging 0.48
R6394:Supt6 UTSW 11 78231065 missense probably damaging 1.00
R6702:Supt6 UTSW 11 78231800 missense possibly damaging 0.93
R6737:Supt6 UTSW 11 78231818 missense probably damaging 0.99
R6853:Supt6 UTSW 11 78232830 missense possibly damaging 0.85
R7213:Supt6 UTSW 11 78232150 missense probably damaging 1.00
R7259:Supt6 UTSW 11 78207616 missense probably damaging 0.99
R7609:Supt6 UTSW 11 78226951 missense probably benign 0.01
R7776:Supt6 UTSW 11 78209529 missense probably damaging 0.99
X0067:Supt6 UTSW 11 78232675 missense probably benign
Z1176:Supt6 UTSW 11 78211836 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTAGGCTCAAGCATACGATG -3'
(R):5'- ACATCAATCTTGCAGGTAGGG -3'

Sequencing Primer
(F):5'- ACCGGATCTGAGTCTATGTAGGAATG -3'
(R):5'- CATCAATCTTGCAGGTAGGGTGTTTG -3'
Posted On2018-08-01