Incidental Mutation 'R6751:Ifrd1'
ID530795
Institutional Source Beutler Lab
Gene Symbol Ifrd1
Ensembl Gene ENSMUSG00000001627
Gene Nameinterferon-related developmental regulator 1
SynonymsTis7, PC4, Ifnl
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.523) question?
Stock #R6751 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location40201567-40248504 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 40203914 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001672] [ENSMUST00000095760] [ENSMUST00000165027] [ENSMUST00000171530] [ENSMUST00000220951]
Predicted Effect probably null
Transcript: ENSMUST00000001672
SMART Domains Protein: ENSMUSP00000001672
Gene: ENSMUSG00000001627

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
Pfam:IFRD 40 345 1.1e-115 PFAM
Pfam:IFRD_C 390 443 6.7e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095760
SMART Domains Protein: ENSMUSP00000093434
Gene: ENSMUSG00000071342

DomainStartEndE-ValueType
Pfam:DUF4577 1 128 1.5e-73 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000164047
SMART Domains Protein: ENSMUSP00000127553
Gene: ENSMUSG00000001627

DomainStartEndE-ValueType
Pfam:IFRD 1 25 9.3e-11 PFAM
Pfam:IFRD_C 27 80 5.1e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164804
Predicted Effect probably null
Transcript: ENSMUST00000165027
SMART Domains Protein: ENSMUSP00000133028
Gene: ENSMUSG00000001627

DomainStartEndE-ValueType
Pfam:IFRD 1 119 8.6e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170119
Predicted Effect probably benign
Transcript: ENSMUST00000171530
SMART Domains Protein: ENSMUSP00000128635
Gene: ENSMUSG00000001627

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
Pfam:IFRD 40 137 1.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220951
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an immediate early gene that encodes a protein related to interferon-gamma. This protein may function as a transcriptional co-activator/repressor that controls the growth and differentiation of specific cell types during embryonic development and tissue regeneration. Mutations in this gene are associated with sensory/motor neuropathy with ataxia. This gene may also be involved in modulating the pathogenesis of cystic fibrosis lung disease. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygous null mice display impaired muscle regeneration and myogenic differentiation and decreased body weight in older mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,066,210 N387Y probably damaging Het
4932415D10Rik A G 10: 82,283,497 S4560P probably benign Het
Abhd17a T C 10: 80,586,587 E87G probably damaging Het
Aco1 T A 4: 40,188,330 probably null Het
Adcy6 T C 15: 98,596,205 N817S probably benign Het
Ak8 T A 2: 28,709,945 L63* probably null Het
Arhgef28 G A 13: 98,075,247 S76L probably damaging Het
Asap1 A G 15: 64,094,412 L891S possibly damaging Het
Cacng5 C A 11: 107,877,553 M209I probably benign Het
Casr T C 16: 36,515,588 I120V probably benign Het
Chd7 T C 4: 8,833,866 Y1207H probably damaging Het
Chrnb2 A T 3: 89,761,576 F144Y probably damaging Het
Cyp4a14 T A 4: 115,491,194 H362L probably damaging Het
Dym G A 18: 75,286,647 V630M probably damaging Het
Dyrk1b C A 7: 28,186,709 P619Q probably damaging Het
Dyx1c1 A G 9: 72,961,975 T156A probably benign Het
Eml5 T C 12: 98,865,400 D433G probably damaging Het
Fam58b T C 11: 78,751,124 Y180C probably damaging Het
Frem2 A T 3: 53,653,665 S1140R probably damaging Het
Gabra5 T C 7: 57,418,334 R255G probably damaging Het
Galnt17 T A 5: 131,081,590 I304F probably damaging Het
Gpc5 A G 14: 115,369,951 S322G probably benign Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Hmcn1 T A 1: 150,734,518 N1467Y probably damaging Het
Ifna6 T C 4: 88,827,750 L112P probably damaging Het
Il17f A G 1: 20,779,489 M17T probably benign Het
Itga11 G A 9: 62,768,584 V892I probably benign Het
Nckap5l A G 15: 99,423,161 L1246P probably damaging Het
Nlrp4f A T 13: 65,194,429 H467Q probably damaging Het
Ntng2 A G 2: 29,228,043 V131A possibly damaging Het
Olfr550 G A 7: 102,578,499 M1I probably null Het
Olfr889 T G 9: 38,115,975 Y60D probably damaging Het
Olfr970 T A 9: 39,819,897 V86E probably benign Het
Olfr972 T C 9: 39,873,680 V135A probably benign Het
Osbpl8 T C 10: 111,275,013 Y459H possibly damaging Het
Pabpc1 A T 15: 36,597,534 V537D possibly damaging Het
Pde4b A T 4: 102,602,671 M583L probably damaging Het
Phlda1 T C 10: 111,506,694 V97A possibly damaging Het
Pik3cb G T 9: 99,094,521 H174Q probably benign Het
Plxdc2 A T 2: 16,548,141 I117F probably benign Het
Psapl1 C A 5: 36,204,959 C298* probably null Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Rtkn2 T A 10: 68,041,453 F448I probably benign Het
Scn10a T C 9: 119,671,551 R221G probably damaging Het
Serpina3c A G 12: 104,151,500 L193P probably damaging Het
Sox12 T C 2: 152,396,758 Y314C probably damaging Het
Sptbn1 T C 11: 30,117,859 E1772G probably damaging Het
Supt6 A G 11: 78,208,949 V1570A probably benign Het
Synrg T C 11: 83,981,425 F125S probably damaging Het
Tenm4 A T 7: 96,845,712 I1116F possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tfap2d C A 1: 19,103,283 H10N possibly damaging Het
Trpm8 T C 1: 88,384,706 I1103T possibly damaging Het
Vmn1r158 C T 7: 22,789,881 C301Y probably damaging Het
Vmn2r56 T C 7: 12,694,792 I516V probably benign Het
Vmn2r71 G A 7: 85,619,887 probably null Het
Vnn3 C T 10: 23,869,625 R491C probably benign Het
Vps50 A G 6: 3,600,274 Y911C probably damaging Het
Wdr60 A T 12: 116,213,456 V842E possibly damaging Het
Zfp772 C T 7: 7,203,717 R325Q possibly damaging Het
Zranb3 T A 1: 127,959,819 H957L probably benign Het
Zscan20 G T 4: 128,585,875 T941K probably damaging Het
Zscan25 T A 5: 145,290,563 F346I probably damaging Het
Other mutations in Ifrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02186:Ifrd1 APN 12 40214093 missense probably benign 0.00
IGL02442:Ifrd1 APN 12 40216317 splice site probably benign
IGL02942:Ifrd1 APN 12 40217376 critical splice donor site probably null
IGL03119:Ifrd1 APN 12 40212334 missense probably null 0.03
R0107:Ifrd1 UTSW 12 40214081 missense probably damaging 1.00
R0138:Ifrd1 UTSW 12 40207130 splice site probably benign
R0390:Ifrd1 UTSW 12 40214094 splice site probably null
R0627:Ifrd1 UTSW 12 40206987 critical splice donor site probably null
R2061:Ifrd1 UTSW 12 40213245 missense probably benign 0.00
R5779:Ifrd1 UTSW 12 40203370 missense probably damaging 1.00
R5915:Ifrd1 UTSW 12 40213096 missense possibly damaging 0.94
R6000:Ifrd1 UTSW 12 40216244 missense possibly damaging 0.52
R6539:Ifrd1 UTSW 12 40203435 missense probably damaging 1.00
R6800:Ifrd1 UTSW 12 40223158 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTCCTTCTAGAAAATGAGCCTGG -3'
(R):5'- TCAGAGAGCCATTTCACTTCTG -3'

Sequencing Primer
(F):5'- TGAGCCTGGCATTTCACTAAG -3'
(R):5'- GAGCCATTTCACTTCTGTAGTTAGAC -3'
Posted On2018-08-01