Incidental Mutation 'R6751:Adcy6'
ID530805
Institutional Source Beutler Lab
Gene Symbol Adcy6
Ensembl Gene ENSMUSG00000022994
Gene Nameadenylate cyclase 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6751 (G1)
Quality Score188.009
Status Not validated
Chromosome15
Chromosomal Location98589973-98610076 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98596205 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 817 (N817S)
Ref Sequence ENSEMBL: ENSMUSP00000154421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096224] [ENSMUST00000228566] [ENSMUST00000228903]
Predicted Effect probably benign
Transcript: ENSMUST00000096224
AA Change: N819S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093939
Gene: ENSMUSG00000022994
AA Change: N819S

DomainStartEndE-ValueType
low complexity region 150 166 N/A INTRINSIC
low complexity region 169 177 N/A INTRINSIC
low complexity region 212 228 N/A INTRINSIC
CYCc 331 532 2.95e-63 SMART
Pfam:DUF1053 580 669 3.5e-18 PFAM
transmembrane domain 701 723 N/A INTRINSIC
transmembrane domain 744 763 N/A INTRINSIC
transmembrane domain 815 834 N/A INTRINSIC
transmembrane domain 839 861 N/A INTRINSIC
Blast:CYCc 885 929 5e-20 BLAST
CYCc 939 1147 4.81e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226236
Predicted Effect probably benign
Transcript: ENSMUST00000228566
AA Change: N817S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228596
Predicted Effect probably benign
Transcript: ENSMUST00000228903
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adenylyl cyclase family of proteins, which are required for the synthesis of cyclic AMP. All members of this family have an intracellular N-terminus, a tandem repeat of six transmembrane domains separated by a cytoplasmic loop, and a C-terminal cytoplasmic domain. The two cytoplasmic regions bind ATP and form the catalytic core of the protein. Adenylyl cyclases are important effectors of transmembrane signaling pathways and are regulated by the activity of G protein coupled receptor signaling. This protein belongs to a small subclass of adenylyl cyclase proteins that are functionally related and are inhibited by protein kinase A, calcium ions and nitric oxide. A mutation in this gene is associated with arthrogryposis multiplex congenita. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for disruption of this gene show a reduction in calcium uptake and transport in cardiomyocytes as well as mild functional abnormalities in the left ventricle. Mice homozygous for a conditional allele activated in collecting ducts exhibit decreased urine osmilality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,066,210 N387Y probably damaging Het
4932415D10Rik A G 10: 82,283,497 S4560P probably benign Het
Abhd17a T C 10: 80,586,587 E87G probably damaging Het
Aco1 T A 4: 40,188,330 probably null Het
Ak8 T A 2: 28,709,945 L63* probably null Het
Arhgef28 G A 13: 98,075,247 S76L probably damaging Het
Asap1 A G 15: 64,094,412 L891S possibly damaging Het
Cacng5 C A 11: 107,877,553 M209I probably benign Het
Casr T C 16: 36,515,588 I120V probably benign Het
Chd7 T C 4: 8,833,866 Y1207H probably damaging Het
Chrnb2 A T 3: 89,761,576 F144Y probably damaging Het
Cyp4a14 T A 4: 115,491,194 H362L probably damaging Het
Dym G A 18: 75,286,647 V630M probably damaging Het
Dyrk1b C A 7: 28,186,709 P619Q probably damaging Het
Dyx1c1 A G 9: 72,961,975 T156A probably benign Het
Eml5 T C 12: 98,865,400 D433G probably damaging Het
Fam58b T C 11: 78,751,124 Y180C probably damaging Het
Frem2 A T 3: 53,653,665 S1140R probably damaging Het
Gabra5 T C 7: 57,418,334 R255G probably damaging Het
Galnt17 T A 5: 131,081,590 I304F probably damaging Het
Gpc5 A G 14: 115,369,951 S322G probably benign Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Hmcn1 T A 1: 150,734,518 N1467Y probably damaging Het
Ifna6 T C 4: 88,827,750 L112P probably damaging Het
Ifrd1 C T 12: 40,203,914 probably null Het
Il17f A G 1: 20,779,489 M17T probably benign Het
Itga11 G A 9: 62,768,584 V892I probably benign Het
Nckap5l A G 15: 99,423,161 L1246P probably damaging Het
Nlrp4f A T 13: 65,194,429 H467Q probably damaging Het
Ntng2 A G 2: 29,228,043 V131A possibly damaging Het
Olfr550 G A 7: 102,578,499 M1I probably null Het
Olfr889 T G 9: 38,115,975 Y60D probably damaging Het
Olfr970 T A 9: 39,819,897 V86E probably benign Het
Olfr972 T C 9: 39,873,680 V135A probably benign Het
Osbpl8 T C 10: 111,275,013 Y459H possibly damaging Het
Pabpc1 A T 15: 36,597,534 V537D possibly damaging Het
Pde4b A T 4: 102,602,671 M583L probably damaging Het
Phlda1 T C 10: 111,506,694 V97A possibly damaging Het
Pik3cb G T 9: 99,094,521 H174Q probably benign Het
Plxdc2 A T 2: 16,548,141 I117F probably benign Het
Psapl1 C A 5: 36,204,959 C298* probably null Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Rtkn2 T A 10: 68,041,453 F448I probably benign Het
Scn10a T C 9: 119,671,551 R221G probably damaging Het
Serpina3c A G 12: 104,151,500 L193P probably damaging Het
Sox12 T C 2: 152,396,758 Y314C probably damaging Het
Sptbn1 T C 11: 30,117,859 E1772G probably damaging Het
Supt6 A G 11: 78,208,949 V1570A probably benign Het
Synrg T C 11: 83,981,425 F125S probably damaging Het
Tenm4 A T 7: 96,845,712 I1116F possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tfap2d C A 1: 19,103,283 H10N possibly damaging Het
Trpm8 T C 1: 88,384,706 I1103T possibly damaging Het
Vmn1r158 C T 7: 22,789,881 C301Y probably damaging Het
Vmn2r56 T C 7: 12,694,792 I516V probably benign Het
Vmn2r71 G A 7: 85,619,887 probably null Het
Vnn3 C T 10: 23,869,625 R491C probably benign Het
Vps50 A G 6: 3,600,274 Y911C probably damaging Het
Wdr60 A T 12: 116,213,456 V842E possibly damaging Het
Zfp772 C T 7: 7,203,717 R325Q possibly damaging Het
Zranb3 T A 1: 127,959,819 H957L probably benign Het
Zscan20 G T 4: 128,585,875 T941K probably damaging Het
Zscan25 T A 5: 145,290,563 F346I probably damaging Het
Other mutations in Adcy6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Adcy6 APN 15 98598976 missense probably damaging 1.00
IGL01132:Adcy6 APN 15 98597851 missense probably benign 0.14
IGL01642:Adcy6 APN 15 98594509 missense possibly damaging 0.88
IGL01647:Adcy6 APN 15 98600275 missense probably damaging 1.00
IGL01788:Adcy6 APN 15 98596519 nonsense probably null
IGL02122:Adcy6 APN 15 98598882 missense possibly damaging 0.66
IGL02210:Adcy6 APN 15 98594971 missense possibly damaging 0.63
IGL02249:Adcy6 APN 15 98599914 missense probably damaging 1.00
IGL02404:Adcy6 APN 15 98596938 missense probably benign
IGL02691:Adcy6 APN 15 98604304 missense probably damaging 1.00
PIT4515001:Adcy6 UTSW 15 98595146 missense probably benign 0.04
R0178:Adcy6 UTSW 15 98604215 missense probably benign 0.00
R0497:Adcy6 UTSW 15 98597725 critical splice donor site probably null
R0739:Adcy6 UTSW 15 98598379 missense probably benign 0.00
R1454:Adcy6 UTSW 15 98604728 missense probably damaging 1.00
R1473:Adcy6 UTSW 15 98592743 missense probably damaging 0.99
R1536:Adcy6 UTSW 15 98600007 missense probably damaging 1.00
R1927:Adcy6 UTSW 15 98598498 splice site probably null
R2178:Adcy6 UTSW 15 98594355 missense probably damaging 1.00
R2294:Adcy6 UTSW 15 98597441 missense possibly damaging 0.48
R2356:Adcy6 UTSW 15 98597016 splice site probably null
R2898:Adcy6 UTSW 15 98593488 missense probably damaging 1.00
R3001:Adcy6 UTSW 15 98596660 missense probably benign 0.01
R3002:Adcy6 UTSW 15 98596660 missense probably benign 0.01
R3794:Adcy6 UTSW 15 98598943 missense probably damaging 1.00
R3884:Adcy6 UTSW 15 98597174 missense probably benign 0.06
R4348:Adcy6 UTSW 15 98604160 missense probably benign 0.44
R4351:Adcy6 UTSW 15 98604160 missense probably benign 0.44
R4542:Adcy6 UTSW 15 98598988 missense possibly damaging 0.70
R4548:Adcy6 UTSW 15 98598659 missense probably damaging 1.00
R5693:Adcy6 UTSW 15 98603989 missense probably damaging 1.00
R5707:Adcy6 UTSW 15 98598741 missense probably damaging 1.00
R5994:Adcy6 UTSW 15 98593664 missense probably damaging 1.00
R5998:Adcy6 UTSW 15 98594354 nonsense probably null
R6142:Adcy6 UTSW 15 98598422 missense probably benign
R6242:Adcy6 UTSW 15 98604015 nonsense probably null
R6305:Adcy6 UTSW 15 98598645 missense probably benign 0.13
R7130:Adcy6 UTSW 15 98597229 missense probably benign
R7335:Adcy6 UTSW 15 98603876 missense probably benign 0.29
R7643:Adcy6 UTSW 15 98593568 missense probably benign
R7658:Adcy6 UTSW 15 98596067 missense probably benign 0.00
X0020:Adcy6 UTSW 15 98598735 missense probably damaging 0.99
X0021:Adcy6 UTSW 15 98603942 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GAGGGACTGTGGATTAGCTTAC -3'
(R):5'- CTCAAAGTATTCCCCGACTCTAGG -3'

Sequencing Primer
(F):5'- GCTTACAAGCCATGGACGC -3'
(R):5'- CCCGACTCTAGGGGCAAC -3'
Posted On2018-08-01