Incidental Mutation 'R6752:Akt3'
ID530811
Institutional Source Beutler Lab
Gene Symbol Akt3
Ensembl Gene ENSMUSG00000019699
Gene Namethymoma viral proto-oncogene 3
SynonymsD930002M15Rik, Nmf350, PKB gamma
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.589) question?
Stock #R6752 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location177020073-177258203 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 177050190 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 337 (Y337*)
Ref Sequence ENSEMBL: ENSMUSP00000106790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019843] [ENSMUST00000111159] [ENSMUST00000111160]
Predicted Effect probably null
Transcript: ENSMUST00000019843
AA Change: Y337*
SMART Domains Protein: ENSMUSP00000019843
Gene: ENSMUSG00000019699
AA Change: Y337*

DomainStartEndE-ValueType
PH 6 109 4.81e-16 SMART
S_TKc 148 405 3.53e-106 SMART
S_TK_X 406 467 6.37e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111159
AA Change: Y337*
SMART Domains Protein: ENSMUSP00000106789
Gene: ENSMUSG00000019699
AA Change: Y337*

DomainStartEndE-ValueType
PH 6 109 4.81e-16 SMART
S_TKc 148 405 3.53e-106 SMART
S_TK_X 406 475 2.61e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111160
AA Change: Y337*
SMART Domains Protein: ENSMUSP00000106790
Gene: ENSMUSG00000019699
AA Change: Y337*

DomainStartEndE-ValueType
PH 6 109 4.81e-16 SMART
S_TKc 148 405 3.53e-106 SMART
S_TK_X 406 475 2.61e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193760
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the AKT, also called PKB, serine/threonine protein kinase family. AKT kinases are known to be regulators of cell signaling in response to insulin and growth factors. They are involved in a wide variety of biological processes including cell proliferation, differentiation, apoptosis, tumorigenesis, as well as glycogen synthesis and glucose uptake. This kinase has been shown to be stimulated by platelet-derived growth factor (PDGF), insulin, and insulin-like growth factor 1 (IGF1). Alternatively splice transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit a 20% decrease in brain size and have smaller and fewer cells in the brain. Mice heterozygous for an ENU-induced mutation exhibit increased seizures (sporadic and induced) and increased brain weight and size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,195,483 L45S probably benign Het
Agbl2 G A 2: 90,803,074 C518Y probably damaging Het
Aox1 T C 1: 58,047,239 I101T probably benign Het
Arhgap23 T C 11: 97,452,248 F241S probably damaging Het
Asmt A G X: 170,676,361 M202V probably benign Het
Atp6v0a2 A G 5: 124,641,514 E189G probably damaging Het
Birc3 G A 9: 7,857,344 A376V probably benign Het
Ccbe1 C T 18: 66,076,307 probably null Het
Chst2 C A 9: 95,404,749 E515* probably null Het
Col12a1 A T 9: 79,633,424 N2426K possibly damaging Het
Dmrt2 A G 19: 25,678,342 N435S probably damaging Het
Dnah14 A G 1: 181,593,452 K123E probably benign Het
Dock4 T A 12: 40,820,617 L1452Q probably damaging Het
Galnt7 G A 8: 57,652,951 R10C probably damaging Het
Gm16506 A G 14: 43,727,419 I22T unknown Het
H2-Q6 A G 17: 35,428,127 T292A probably damaging Het
Ifne A G 4: 88,880,082 M33T probably benign Het
Igf2r G A 17: 12,714,944 R808W probably damaging Het
Igfbp5 T C 1: 72,863,909 E169G probably damaging Het
Inppl1 G A 7: 101,832,542 R198* probably null Het
Irgm1 T C 11: 48,866,463 T174A probably damaging Het
Itih3 C T 14: 30,923,489 G21S possibly damaging Het
Klra4 G T 6: 130,062,028 Q134K probably benign Het
Mfsd1 T A 3: 67,596,603 Y309* probably null Het
Mrps10 A G 17: 47,377,815 N162S probably damaging Het
Mtmr14 T C 6: 113,240,397 F90S probably damaging Het
Myh15 A G 16: 49,182,927 D1783G probably damaging Het
Myo3b A G 2: 70,289,512 E972G probably damaging Het
Myt1 G T 2: 181,801,082 V455F probably damaging Het
Nbea T A 3: 55,968,309 T1647S probably benign Het
Nbea A T 3: 56,037,219 S575T probably benign Het
Ntn4 A G 10: 93,734,175 N466S probably benign Het
Olfr1113 A G 2: 87,213,044 M51V probably benign Het
Olfr1468-ps1 T A 19: 13,375,526 L188H unknown Het
Olfr197 T A 16: 59,186,331 N51Y probably damaging Het
Pcdhgb4 T A 18: 37,720,651 I33N probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pom121l2 T G 13: 21,981,769 F70C probably damaging Het
Psmb5 T C 14: 54,616,755 T89A probably benign Het
Rab11fip2 T C 19: 59,907,043 D471G probably damaging Het
Rnh1 A G 7: 141,163,441 V207A probably benign Het
Sh3tc2 C A 18: 61,961,037 T49N probably benign Het
Skint4 T C 4: 112,119,863 M158T possibly damaging Het
Skint7 T A 4: 111,980,266 H80Q probably benign Het
Smg1 A G 7: 118,163,316 probably benign Het
Sostdc1 T C 12: 36,314,412 V40A probably benign Het
Sptlc1 C A 13: 53,335,358 K437N possibly damaging Het
Stat2 T C 10: 128,283,753 F503L probably damaging Het
Syt16 A T 12: 74,229,213 probably null Het
Tspyl1 T C 10: 34,282,587 S103P probably benign Het
Ube4a A T 9: 44,925,948 S1053R probably damaging Het
Vipr1 A G 9: 121,653,893 N58S probably damaging Het
Zfp184 C A 13: 21,959,408 A428E probably damaging Het
Zfp292 A C 4: 34,808,593 F1484V possibly damaging Het
Zfp599 G A 9: 22,249,544 H442Y probably damaging Het
Zfp944 G A 17: 22,339,519 T249I probably benign Het
Zkscan14 T A 5: 145,195,506 H405L probably damaging Het
Other mutations in Akt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Akt3 APN 1 177130967 splice site probably benign
IGL02348:Akt3 APN 1 177059386 missense probably damaging 0.99
IGL02394:Akt3 APN 1 177059419 missense probably damaging 1.00
IGL03005:Akt3 APN 1 177067227 missense probably damaging 1.00
R0114:Akt3 UTSW 1 177067251 missense probably damaging 1.00
R1403:Akt3 UTSW 1 177131110 splice site probably benign
R1452:Akt3 UTSW 1 177131067 missense possibly damaging 0.93
R1495:Akt3 UTSW 1 177103042 missense probably benign
R1961:Akt3 UTSW 1 177096995 missense probably damaging 0.97
R2062:Akt3 UTSW 1 177102985 missense possibly damaging 0.93
R2064:Akt3 UTSW 1 177102985 missense possibly damaging 0.93
R2066:Akt3 UTSW 1 177102985 missense possibly damaging 0.93
R2068:Akt3 UTSW 1 177102985 missense possibly damaging 0.93
R4155:Akt3 UTSW 1 177096977 missense possibly damaging 0.92
R4937:Akt3 UTSW 1 177050127 missense possibly damaging 0.89
R5097:Akt3 UTSW 1 177248688 missense probably benign 0.01
R5414:Akt3 UTSW 1 177050251 missense probably damaging 0.98
R6336:Akt3 UTSW 1 177031712 missense probably damaging 1.00
R6723:Akt3 UTSW 1 177050190 nonsense probably null
R6753:Akt3 UTSW 1 177050190 nonsense probably null
R6755:Akt3 UTSW 1 177050190 nonsense probably null
R6765:Akt3 UTSW 1 177050190 nonsense probably null
R6766:Akt3 UTSW 1 177050190 nonsense probably null
R6767:Akt3 UTSW 1 177050190 nonsense probably null
R6782:Akt3 UTSW 1 177050190 nonsense probably null
R6787:Akt3 UTSW 1 177050190 nonsense probably null
R6847:Akt3 UTSW 1 177031659 missense probably damaging 1.00
R7525:Akt3 UTSW 1 177020107 nonsense probably null
R7535:Akt3 UTSW 1 177097034 missense probably damaging 1.00
R8000:Akt3 UTSW 1 177050197 missense probably damaging 1.00
R8326:Akt3 UTSW 1 177050045 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGGACCATCATTGAAGCTTACC -3'
(R):5'- CAGCTCCATAGGTTGTCATTGG -3'

Sequencing Primer
(F):5'- GAAGCTTACCGTTTATTTGGATCC -3'
(R):5'- GGCTAGTCTACATAGCAAGTTCCAG -3'
Posted On2018-08-01