Incidental Mutation 'R6752:Olfr1113'
ID530814
Institutional Source Beutler Lab
Gene Symbol Olfr1113
Ensembl Gene ENSMUSG00000070857
Gene Nameolfactory receptor 1113
SynonymsMOR264-25, GA_x6K02T2Q125-48697747-48698727
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6752 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87208970-87214650 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87213044 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 51 (M51V)
Ref Sequence ENSEMBL: ENSMUSP00000150991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079966] [ENSMUST00000215611]
Predicted Effect probably benign
Transcript: ENSMUST00000079966
AA Change: M51V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078883
Gene: ENSMUSG00000070857
AA Change: M51V

DomainStartEndE-ValueType
Pfam:7tm_4 46 323 6.7e-53 PFAM
Pfam:7tm_1 56 305 2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215611
AA Change: M51V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,195,483 L45S probably benign Het
Agbl2 G A 2: 90,803,074 C518Y probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Aox1 T C 1: 58,047,239 I101T probably benign Het
Arhgap23 T C 11: 97,452,248 F241S probably damaging Het
Asmt A G X: 170,676,361 M202V probably benign Het
Atp6v0a2 A G 5: 124,641,514 E189G probably damaging Het
Birc3 G A 9: 7,857,344 A376V probably benign Het
Ccbe1 C T 18: 66,076,307 probably null Het
Chst2 C A 9: 95,404,749 E515* probably null Het
Col12a1 A T 9: 79,633,424 N2426K possibly damaging Het
Dmrt2 A G 19: 25,678,342 N435S probably damaging Het
Dnah14 A G 1: 181,593,452 K123E probably benign Het
Dock4 T A 12: 40,820,617 L1452Q probably damaging Het
Galnt7 G A 8: 57,652,951 R10C probably damaging Het
Gm16506 A G 14: 43,727,419 I22T unknown Het
H2-Q6 A G 17: 35,428,127 T292A probably damaging Het
Ifne A G 4: 88,880,082 M33T probably benign Het
Igf2r G A 17: 12,714,944 R808W probably damaging Het
Igfbp5 T C 1: 72,863,909 E169G probably damaging Het
Inppl1 G A 7: 101,832,542 R198* probably null Het
Irgm1 T C 11: 48,866,463 T174A probably damaging Het
Itih3 C T 14: 30,923,489 G21S possibly damaging Het
Klra4 G T 6: 130,062,028 Q134K probably benign Het
Mfsd1 T A 3: 67,596,603 Y309* probably null Het
Mrps10 A G 17: 47,377,815 N162S probably damaging Het
Mtmr14 T C 6: 113,240,397 F90S probably damaging Het
Myh15 A G 16: 49,182,927 D1783G probably damaging Het
Myo3b A G 2: 70,289,512 E972G probably damaging Het
Myt1 G T 2: 181,801,082 V455F probably damaging Het
Nbea T A 3: 55,968,309 T1647S probably benign Het
Nbea A T 3: 56,037,219 S575T probably benign Het
Ntn4 A G 10: 93,734,175 N466S probably benign Het
Olfr1468-ps1 T A 19: 13,375,526 L188H unknown Het
Olfr197 T A 16: 59,186,331 N51Y probably damaging Het
Pcdhgb4 T A 18: 37,720,651 I33N probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pom121l2 T G 13: 21,981,769 F70C probably damaging Het
Psmb5 T C 14: 54,616,755 T89A probably benign Het
Rab11fip2 T C 19: 59,907,043 D471G probably damaging Het
Rnh1 A G 7: 141,163,441 V207A probably benign Het
Sh3tc2 C A 18: 61,961,037 T49N probably benign Het
Skint4 T C 4: 112,119,863 M158T possibly damaging Het
Skint7 T A 4: 111,980,266 H80Q probably benign Het
Smg1 A G 7: 118,163,316 probably benign Het
Sostdc1 T C 12: 36,314,412 V40A probably benign Het
Sptlc1 C A 13: 53,335,358 K437N possibly damaging Het
Stat2 T C 10: 128,283,753 F503L probably damaging Het
Syt16 A T 12: 74,229,213 probably null Het
Tspyl1 T C 10: 34,282,587 S103P probably benign Het
Ube4a A T 9: 44,925,948 S1053R probably damaging Het
Vipr1 A G 9: 121,653,893 N58S probably damaging Het
Zfp184 C A 13: 21,959,408 A428E probably damaging Het
Zfp292 A C 4: 34,808,593 F1484V possibly damaging Het
Zfp599 G A 9: 22,249,544 H442Y probably damaging Het
Zfp944 G A 17: 22,339,519 T249I probably benign Het
Zkscan14 T A 5: 145,195,506 H405L probably damaging Het
Other mutations in Olfr1113
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02325:Olfr1113 APN 2 87213506 missense probably damaging 0.96
IGL02523:Olfr1113 APN 2 87213320 missense probably benign 0.26
IGL03112:Olfr1113 APN 2 87213600 missense probably damaging 1.00
IGL03137:Olfr1113 APN 2 87213156 missense probably benign 0.42
R0393:Olfr1113 UTSW 2 87213693 missense probably benign
R1758:Olfr1113 UTSW 2 87213414 missense probably benign 0.13
R1920:Olfr1113 UTSW 2 87213377 missense probably benign 0.09
R1992:Olfr1113 UTSW 2 87213244 nonsense probably null
R3742:Olfr1113 UTSW 2 87212996 missense probably benign 0.00
R5615:Olfr1113 UTSW 2 87213739 missense probably benign 0.00
R5665:Olfr1113 UTSW 2 87213728 missense probably benign 0.05
R5749:Olfr1113 UTSW 2 87212943 missense probably benign
R7986:Olfr1113 UTSW 2 87213578 missense probably benign 0.12
R8161:Olfr1113 UTSW 2 87213804 missense probably damaging 0.96
R8283:Olfr1113 UTSW 2 87213339 missense probably benign 0.04
Z1088:Olfr1113 UTSW 2 87213778 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- AGACTGAAACACAATCCCAATTTGG -3'
(R):5'- GAGGAAGCATTCAGTAGCCC -3'

Sequencing Primer
(F):5'- CACAATCCCAATTTGGTTTAAGAAG -3'
(R):5'- CACATTTGTGTAGCACAGGC -3'
Posted On2018-08-01