Incidental Mutation 'R6752:Skint4'
ID530824
Institutional Source Beutler Lab
Gene Symbol Skint4
Ensembl Gene ENSMUSG00000055960
Gene Nameselection and upkeep of intraepithelial T cells 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6752 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location112072016-112168076 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112119863 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 158 (M158T)
Ref Sequence ENSEMBL: ENSMUSP00000102176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069769] [ENSMUST00000106564] [ENSMUST00000106565] [ENSMUST00000106566]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069769
AA Change: M150T

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000070676
Gene: ENSMUSG00000055960
AA Change: M150T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 33 140 7.24e-10 SMART
Pfam:C2-set_2 141 227 6.2e-8 PFAM
transmembrane domain 242 264 N/A INTRINSIC
transmembrane domain 296 318 N/A INTRINSIC
transmembrane domain 342 364 N/A INTRINSIC
transmembrane domain 383 405 N/A INTRINSIC
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106564
AA Change: M150T

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102174
Gene: ENSMUSG00000055960
AA Change: M150T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 33 140 7.24e-10 SMART
Pfam:C2-set_2 141 227 6.2e-8 PFAM
transmembrane domain 242 264 N/A INTRINSIC
transmembrane domain 296 318 N/A INTRINSIC
transmembrane domain 342 364 N/A INTRINSIC
transmembrane domain 383 405 N/A INTRINSIC
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106565
AA Change: M150T

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102175
Gene: ENSMUSG00000055960
AA Change: M150T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 33 140 7.24e-10 SMART
Pfam:C2-set_2 141 227 6.2e-8 PFAM
transmembrane domain 242 264 N/A INTRINSIC
transmembrane domain 296 318 N/A INTRINSIC
transmembrane domain 342 364 N/A INTRINSIC
transmembrane domain 383 405 N/A INTRINSIC
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106566
AA Change: M158T

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102176
Gene: ENSMUSG00000055960
AA Change: M158T

DomainStartEndE-ValueType
IG 41 148 7.24e-10 SMART
transmembrane domain 250 272 N/A INTRINSIC
transmembrane domain 304 326 N/A INTRINSIC
transmembrane domain 350 372 N/A INTRINSIC
transmembrane domain 391 413 N/A INTRINSIC
transmembrane domain 433 455 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119233
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,195,483 L45S probably benign Het
Agbl2 G A 2: 90,803,074 C518Y probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Aox1 T C 1: 58,047,239 I101T probably benign Het
Arhgap23 T C 11: 97,452,248 F241S probably damaging Het
Asmt A G X: 170,676,361 M202V probably benign Het
Atp6v0a2 A G 5: 124,641,514 E189G probably damaging Het
Birc3 G A 9: 7,857,344 A376V probably benign Het
Ccbe1 C T 18: 66,076,307 probably null Het
Chst2 C A 9: 95,404,749 E515* probably null Het
Col12a1 A T 9: 79,633,424 N2426K possibly damaging Het
Dmrt2 A G 19: 25,678,342 N435S probably damaging Het
Dnah14 A G 1: 181,593,452 K123E probably benign Het
Dock4 T A 12: 40,820,617 L1452Q probably damaging Het
Galnt7 G A 8: 57,652,951 R10C probably damaging Het
Gm16506 A G 14: 43,727,419 I22T unknown Het
H2-Q6 A G 17: 35,428,127 T292A probably damaging Het
Ifne A G 4: 88,880,082 M33T probably benign Het
Igf2r G A 17: 12,714,944 R808W probably damaging Het
Igfbp5 T C 1: 72,863,909 E169G probably damaging Het
Inppl1 G A 7: 101,832,542 R198* probably null Het
Irgm1 T C 11: 48,866,463 T174A probably damaging Het
Itih3 C T 14: 30,923,489 G21S possibly damaging Het
Klra4 G T 6: 130,062,028 Q134K probably benign Het
Mfsd1 T A 3: 67,596,603 Y309* probably null Het
Mrps10 A G 17: 47,377,815 N162S probably damaging Het
Mtmr14 T C 6: 113,240,397 F90S probably damaging Het
Myh15 A G 16: 49,182,927 D1783G probably damaging Het
Myo3b A G 2: 70,289,512 E972G probably damaging Het
Myt1 G T 2: 181,801,082 V455F probably damaging Het
Nbea T A 3: 55,968,309 T1647S probably benign Het
Nbea A T 3: 56,037,219 S575T probably benign Het
Ntn4 A G 10: 93,734,175 N466S probably benign Het
Olfr1113 A G 2: 87,213,044 M51V probably benign Het
Olfr1468-ps1 T A 19: 13,375,526 L188H unknown Het
Olfr197 T A 16: 59,186,331 N51Y probably damaging Het
Pcdhgb4 T A 18: 37,720,651 I33N probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pom121l2 T G 13: 21,981,769 F70C probably damaging Het
Psmb5 T C 14: 54,616,755 T89A probably benign Het
Rab11fip2 T C 19: 59,907,043 D471G probably damaging Het
Rnh1 A G 7: 141,163,441 V207A probably benign Het
Sh3tc2 C A 18: 61,961,037 T49N probably benign Het
Skint7 T A 4: 111,980,266 H80Q probably benign Het
Smg1 A G 7: 118,163,316 probably benign Het
Sostdc1 T C 12: 36,314,412 V40A probably benign Het
Sptlc1 C A 13: 53,335,358 K437N possibly damaging Het
Stat2 T C 10: 128,283,753 F503L probably damaging Het
Syt16 A T 12: 74,229,213 probably null Het
Tspyl1 T C 10: 34,282,587 S103P probably benign Het
Ube4a A T 9: 44,925,948 S1053R probably damaging Het
Vipr1 A G 9: 121,653,893 N58S probably damaging Het
Zfp184 C A 13: 21,959,408 A428E probably damaging Het
Zfp292 A C 4: 34,808,593 F1484V possibly damaging Het
Zfp599 G A 9: 22,249,544 H442Y probably damaging Het
Zfp944 G A 17: 22,339,519 T249I probably benign Het
Zkscan14 T A 5: 145,195,506 H405L probably damaging Het
Other mutations in Skint4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Skint4 APN 4 112120010 missense possibly damaging 0.86
IGL01654:Skint4 APN 4 112120057 missense probably damaging 0.99
IGL02040:Skint4 APN 4 112146482 splice site probably benign
IGL02328:Skint4 APN 4 112120058 missense possibly damaging 0.92
IGL02811:Skint4 APN 4 112087003 missense possibly damaging 0.86
IGL02965:Skint4 APN 4 112136021 missense probably benign 0.01
IGL03039:Skint4 APN 4 112124650 missense probably benign 0.20
IGL03060:Skint4 APN 4 112118235 missense probably benign 0.33
IGL03075:Skint4 APN 4 112087042 missense probably damaging 1.00
IGL03352:Skint4 APN 4 112165686 missense possibly damaging 0.96
PIT4378001:Skint4 UTSW 4 112087035 missense probably benign 0.01
R0483:Skint4 UTSW 4 112117939 splice site probably benign
R1175:Skint4 UTSW 4 112124596 missense probably benign 0.14
R1446:Skint4 UTSW 4 112118114 missense probably benign 0.11
R1641:Skint4 UTSW 4 112136043 missense possibly damaging 0.93
R1983:Skint4 UTSW 4 112146492 missense probably benign 0.00
R2168:Skint4 UTSW 4 112086986 critical splice acceptor site probably null
R2272:Skint4 UTSW 4 112119868 missense probably benign 0.01
R2287:Skint4 UTSW 4 112118205 missense possibly damaging 0.70
R3801:Skint4 UTSW 4 112118181 missense probably damaging 0.98
R3802:Skint4 UTSW 4 112118181 missense probably damaging 0.98
R3804:Skint4 UTSW 4 112118181 missense probably damaging 0.98
R4009:Skint4 UTSW 4 112120109 missense possibly damaging 0.70
R4050:Skint4 UTSW 4 112124614 missense probably benign 0.01
R4564:Skint4 UTSW 4 112119869 missense probably damaging 0.99
R4581:Skint4 UTSW 4 112087042 missense probably damaging 1.00
R4587:Skint4 UTSW 4 112087024 missense probably damaging 0.99
R4674:Skint4 UTSW 4 112118233 missense probably damaging 1.00
R4723:Skint4 UTSW 4 112118236 missense possibly damaging 0.70
R4753:Skint4 UTSW 4 112146531 missense probably benign 0.00
R4775:Skint4 UTSW 4 112136064 missense probably damaging 0.97
R4832:Skint4 UTSW 4 112143766 missense possibly damaging 0.49
R5299:Skint4 UTSW 4 112136006 missense possibly damaging 0.59
R6118:Skint4 UTSW 4 112119822 splice site probably null
R6433:Skint4 UTSW 4 112146510 missense probably benign 0.00
R6616:Skint4 UTSW 4 112118230 missense possibly damaging 0.70
R6698:Skint4 UTSW 4 112119899 missense probably damaging 1.00
R7034:Skint4 UTSW 4 112158084 missense possibly damaging 0.53
R7102:Skint4 UTSW 4 112118101 missense probably damaging 1.00
R7602:Skint4 UTSW 4 112118271 missense possibly damaging 0.50
R8027:Skint4 UTSW 4 112157985 critical splice acceptor site probably null
R8038:Skint4 UTSW 4 112119806 intron probably benign
R8147:Skint4 UTSW 4 112136021 missense probably benign 0.06
R8375:Skint4 UTSW 4 112117976 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACGAACTTCTTAGGCAATGTG -3'
(R):5'- GGTGAGTTACAAGGTTTTGAAAGTAGC -3'

Sequencing Primer
(F):5'- CAATGTGCATCCTATGTGTTTTGAC -3'
(R):5'- CAAATGACATTCCTGTGAGAGCTG -3'
Posted On2018-08-01