Incidental Mutation 'R6752:Klra4'
ID530828
Institutional Source Beutler Lab
Gene Symbol Klra4
Ensembl Gene ENSMUSG00000079852
Gene Namekiller cell lectin-like receptor, subfamily A, member 4
SynonymsLy49d, Chok, ly49r<129>
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6752 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location130043731-130067271 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 130062028 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 134 (Q134K)
Ref Sequence ENSEMBL: ENSMUSP00000114004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119096]
Predicted Effect probably benign
Transcript: ENSMUST00000119096
AA Change: Q134K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000114004
Gene: ENSMUSG00000079852
AA Change: Q134K

DomainStartEndE-ValueType
CLECT 140 255 1.78e-16 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,195,483 L45S probably benign Het
Agbl2 G A 2: 90,803,074 C518Y probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Aox1 T C 1: 58,047,239 I101T probably benign Het
Arhgap23 T C 11: 97,452,248 F241S probably damaging Het
Asmt A G X: 170,676,361 M202V probably benign Het
Atp6v0a2 A G 5: 124,641,514 E189G probably damaging Het
Birc3 G A 9: 7,857,344 A376V probably benign Het
Ccbe1 C T 18: 66,076,307 probably null Het
Chst2 C A 9: 95,404,749 E515* probably null Het
Col12a1 A T 9: 79,633,424 N2426K possibly damaging Het
Dmrt2 A G 19: 25,678,342 N435S probably damaging Het
Dnah14 A G 1: 181,593,452 K123E probably benign Het
Dock4 T A 12: 40,820,617 L1452Q probably damaging Het
Galnt7 G A 8: 57,652,951 R10C probably damaging Het
Gm16506 A G 14: 43,727,419 I22T unknown Het
H2-Q6 A G 17: 35,428,127 T292A probably damaging Het
Ifne A G 4: 88,880,082 M33T probably benign Het
Igf2r G A 17: 12,714,944 R808W probably damaging Het
Igfbp5 T C 1: 72,863,909 E169G probably damaging Het
Inppl1 G A 7: 101,832,542 R198* probably null Het
Irgm1 T C 11: 48,866,463 T174A probably damaging Het
Itih3 C T 14: 30,923,489 G21S possibly damaging Het
Mfsd1 T A 3: 67,596,603 Y309* probably null Het
Mrps10 A G 17: 47,377,815 N162S probably damaging Het
Mtmr14 T C 6: 113,240,397 F90S probably damaging Het
Myh15 A G 16: 49,182,927 D1783G probably damaging Het
Myo3b A G 2: 70,289,512 E972G probably damaging Het
Myt1 G T 2: 181,801,082 V455F probably damaging Het
Nbea T A 3: 55,968,309 T1647S probably benign Het
Nbea A T 3: 56,037,219 S575T probably benign Het
Ntn4 A G 10: 93,734,175 N466S probably benign Het
Olfr1113 A G 2: 87,213,044 M51V probably benign Het
Olfr1468-ps1 T A 19: 13,375,526 L188H unknown Het
Olfr197 T A 16: 59,186,331 N51Y probably damaging Het
Pcdhgb4 T A 18: 37,720,651 I33N probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pom121l2 T G 13: 21,981,769 F70C probably damaging Het
Psmb5 T C 14: 54,616,755 T89A probably benign Het
Rab11fip2 T C 19: 59,907,043 D471G probably damaging Het
Rnh1 A G 7: 141,163,441 V207A probably benign Het
Sh3tc2 C A 18: 61,961,037 T49N probably benign Het
Skint4 T C 4: 112,119,863 M158T possibly damaging Het
Skint7 T A 4: 111,980,266 H80Q probably benign Het
Smg1 A G 7: 118,163,316 probably benign Het
Sostdc1 T C 12: 36,314,412 V40A probably benign Het
Sptlc1 C A 13: 53,335,358 K437N possibly damaging Het
Stat2 T C 10: 128,283,753 F503L probably damaging Het
Syt16 A T 12: 74,229,213 probably null Het
Tspyl1 T C 10: 34,282,587 S103P probably benign Het
Ube4a A T 9: 44,925,948 S1053R probably damaging Het
Vipr1 A G 9: 121,653,893 N58S probably damaging Het
Zfp184 C A 13: 21,959,408 A428E probably damaging Het
Zfp292 A C 4: 34,808,593 F1484V possibly damaging Het
Zfp599 G A 9: 22,249,544 H442Y probably damaging Het
Zfp944 G A 17: 22,339,519 T249I probably benign Het
Zkscan14 T A 5: 145,195,506 H405L probably damaging Het
Other mutations in Klra4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Klra4 APN 6 130062022 missense probably benign 0.18
IGL02189:Klra4 APN 6 130044142 missense possibly damaging 0.68
IGL02510:Klra4 APN 6 130059543 missense probably damaging 1.00
IGL02887:Klra4 APN 6 130044070 missense probably damaging 1.00
R1388:Klra4 UTSW 6 130062235 splice site probably benign
R1933:Klra4 UTSW 6 130065244 missense possibly damaging 0.83
R3121:Klra4 UTSW 6 130063178 missense probably benign 0.00
R5205:Klra4 UTSW 6 130062117 missense probably damaging 0.99
R5223:Klra4 UTSW 6 130062147 missense probably damaging 1.00
R5589:Klra4 UTSW 6 130062154 missense probably benign 0.41
R5930:Klra4 UTSW 6 130053053 missense possibly damaging 0.95
R5931:Klra4 UTSW 6 130053053 missense possibly damaging 0.95
R5932:Klra4 UTSW 6 130053053 missense possibly damaging 0.95
R6452:Klra4 UTSW 6 130065366 splice site probably null
R6789:Klra4 UTSW 6 130062219 missense probably damaging 1.00
R6841:Klra4 UTSW 6 130065199 missense probably benign 0.01
R7255:Klra4 UTSW 6 130059642 missense probably damaging 0.99
R7901:Klra4 UTSW 6 130063150 missense probably damaging 1.00
R8284:Klra4 UTSW 6 130065280 missense possibly damaging 0.49
R8340:Klra4 UTSW 6 130065294 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- AACTTCTGAGTTTCCAGACCCC -3'
(R):5'- GTGAGGTTACTTCCACCGTAATTTTC -3'

Sequencing Primer
(F):5'- GAGTTTCCAGACCCCTACATG -3'
(R):5'- GGTGTCAACATGAAGCTTTTTCTC -3'
Posted On2018-08-01