Incidental Mutation 'R6752:Galnt7'
ID530832
Institutional Source Beutler Lab
Gene Symbol Galnt7
Ensembl Gene ENSMUSG00000031608
Gene Namepolypeptide N-acetylgalactosaminyltransferase 7
SynonymsppGaNTase-T7
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.497) question?
Stock #R6752 (G1)
Quality Score223.009
Status Validated
Chromosome8
Chromosomal Location57523828-57653032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 57652951 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 10 (R10C)
Ref Sequence ENSEMBL: ENSMUSP00000105945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034021] [ENSMUST00000110316]
Predicted Effect probably damaging
Transcript: ENSMUST00000034021
AA Change: R10C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034021
Gene: ENSMUSG00000031608
AA Change: R10C

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
Pfam:Glycos_transf_2 210 399 3e-28 PFAM
Pfam:Glyco_tranf_2_2 210 490 2e-7 PFAM
Pfam:Glyco_transf_7C 375 445 1.8e-8 PFAM
RICIN 531 652 3.39e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110316
AA Change: R10C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105945
Gene: ENSMUSG00000031608
AA Change: R10C

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
Pfam:Glycos_transf_2 210 399 8.2e-27 PFAM
Pfam:Glyco_tranf_2_2 210 490 1.3e-7 PFAM
Pfam:Glyco_transf_7C 369 445 9.3e-9 PFAM
RICIN 531 652 3.39e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210975
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211700
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes GalNAc transferase 7, a member of the GalNAc-transferase family. The enzyme encoded by this gene controls the initiation step of mucin-type O-linked protein glycosylation and transfer of N-acetylgalactosamine to serine and threonine amino acid residues. This enzyme is a type II transmembrane protein and shares common sequence motifs with other family members. Unlike other family members, this enzyme shows exclusive specificity for partially GalNAc-glycosylated acceptor substrates and shows no activity with non-glycosylated peptides. This protein may function as a follow-up enzyme in the initiation step of O-glycosylation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,195,483 L45S probably benign Het
Agbl2 G A 2: 90,803,074 C518Y probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Aox1 T C 1: 58,047,239 I101T probably benign Het
Arhgap23 T C 11: 97,452,248 F241S probably damaging Het
Asmt A G X: 170,676,361 M202V probably benign Het
Atp6v0a2 A G 5: 124,641,514 E189G probably damaging Het
Birc3 G A 9: 7,857,344 A376V probably benign Het
Ccbe1 C T 18: 66,076,307 probably null Het
Chst2 C A 9: 95,404,749 E515* probably null Het
Col12a1 A T 9: 79,633,424 N2426K possibly damaging Het
Dmrt2 A G 19: 25,678,342 N435S probably damaging Het
Dnah14 A G 1: 181,593,452 K123E probably benign Het
Dock4 T A 12: 40,820,617 L1452Q probably damaging Het
Gm16506 A G 14: 43,727,419 I22T unknown Het
H2-Q6 A G 17: 35,428,127 T292A probably damaging Het
Ifne A G 4: 88,880,082 M33T probably benign Het
Igf2r G A 17: 12,714,944 R808W probably damaging Het
Igfbp5 T C 1: 72,863,909 E169G probably damaging Het
Inppl1 G A 7: 101,832,542 R198* probably null Het
Irgm1 T C 11: 48,866,463 T174A probably damaging Het
Itih3 C T 14: 30,923,489 G21S possibly damaging Het
Klra4 G T 6: 130,062,028 Q134K probably benign Het
Mfsd1 T A 3: 67,596,603 Y309* probably null Het
Mrps10 A G 17: 47,377,815 N162S probably damaging Het
Mtmr14 T C 6: 113,240,397 F90S probably damaging Het
Myh15 A G 16: 49,182,927 D1783G probably damaging Het
Myo3b A G 2: 70,289,512 E972G probably damaging Het
Myt1 G T 2: 181,801,082 V455F probably damaging Het
Nbea T A 3: 55,968,309 T1647S probably benign Het
Nbea A T 3: 56,037,219 S575T probably benign Het
Ntn4 A G 10: 93,734,175 N466S probably benign Het
Olfr1113 A G 2: 87,213,044 M51V probably benign Het
Olfr1468-ps1 T A 19: 13,375,526 L188H unknown Het
Olfr197 T A 16: 59,186,331 N51Y probably damaging Het
Pcdhgb4 T A 18: 37,720,651 I33N probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pom121l2 T G 13: 21,981,769 F70C probably damaging Het
Psmb5 T C 14: 54,616,755 T89A probably benign Het
Rab11fip2 T C 19: 59,907,043 D471G probably damaging Het
Rnh1 A G 7: 141,163,441 V207A probably benign Het
Sh3tc2 C A 18: 61,961,037 T49N probably benign Het
Skint4 T C 4: 112,119,863 M158T possibly damaging Het
Skint7 T A 4: 111,980,266 H80Q probably benign Het
Smg1 A G 7: 118,163,316 probably benign Het
Sostdc1 T C 12: 36,314,412 V40A probably benign Het
Sptlc1 C A 13: 53,335,358 K437N possibly damaging Het
Stat2 T C 10: 128,283,753 F503L probably damaging Het
Syt16 A T 12: 74,229,213 probably null Het
Tspyl1 T C 10: 34,282,587 S103P probably benign Het
Ube4a A T 9: 44,925,948 S1053R probably damaging Het
Vipr1 A G 9: 121,653,893 N58S probably damaging Het
Zfp184 C A 13: 21,959,408 A428E probably damaging Het
Zfp292 A C 4: 34,808,593 F1484V possibly damaging Het
Zfp599 G A 9: 22,249,544 H442Y probably damaging Het
Zfp944 G A 17: 22,339,519 T249I probably benign Het
Zkscan14 T A 5: 145,195,506 H405L probably damaging Het
Other mutations in Galnt7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Galnt7 APN 8 57540039 missense probably damaging 1.00
IGL00538:Galnt7 APN 8 57552522 missense possibly damaging 0.95
IGL00826:Galnt7 APN 8 57540071 nonsense probably null
IGL00951:Galnt7 APN 8 57583824 missense probably damaging 0.96
IGL01662:Galnt7 APN 8 57531735 splice site probably benign
IGL02280:Galnt7 APN 8 57536790 missense probably damaging 1.00
IGL02832:Galnt7 APN 8 57552497 missense probably damaging 1.00
IGL02936:Galnt7 APN 8 57584214 missense probably benign
IGL03083:Galnt7 APN 8 57526189 missense probably damaging 0.98
IGL03387:Galnt7 APN 8 57526178 missense probably benign 0.01
R0400:Galnt7 UTSW 8 57583989 missense probably damaging 0.99
R0553:Galnt7 UTSW 8 57552430 splice site probably benign
R1463:Galnt7 UTSW 8 57652858 missense probably benign
R1487:Galnt7 UTSW 8 57540039 missense probably damaging 1.00
R1791:Galnt7 UTSW 8 57542530 missense probably benign 0.05
R1817:Galnt7 UTSW 8 57538178 missense probably damaging 1.00
R1962:Galnt7 UTSW 8 57532714 missense probably benign 0.13
R3855:Galnt7 UTSW 8 57532624 splice site probably benign
R3856:Galnt7 UTSW 8 57532624 splice site probably benign
R4232:Galnt7 UTSW 8 57652966 missense probably benign
R4396:Galnt7 UTSW 8 57538181 missense probably damaging 1.00
R4426:Galnt7 UTSW 8 57552572 nonsense probably null
R4610:Galnt7 UTSW 8 57545769 missense probably damaging 0.99
R4745:Galnt7 UTSW 8 57542727 intron probably benign
R4794:Galnt7 UTSW 8 57545363 missense probably damaging 1.00
R5014:Galnt7 UTSW 8 57545380 missense probably damaging 1.00
R5177:Galnt7 UTSW 8 57584027 missense possibly damaging 0.87
R5682:Galnt7 UTSW 8 57583933 nonsense probably null
R6122:Galnt7 UTSW 8 57526166 missense probably damaging 0.99
R6276:Galnt7 UTSW 8 57536578 splice site probably null
R6684:Galnt7 UTSW 8 57538109 missense probably benign 0.16
R7464:Galnt7 UTSW 8 57584020 missense possibly damaging 0.95
R7491:Galnt7 UTSW 8 57552518 missense probably damaging 0.97
R7547:Galnt7 UTSW 8 57583962 missense possibly damaging 0.48
R8093:Galnt7 UTSW 8 57532705 missense probably benign 0.00
R8221:Galnt7 UTSW 8 57552566 missense possibly damaging 0.93
R8248:Galnt7 UTSW 8 57538188 missense probably benign 0.34
R8402:Galnt7 UTSW 8 57542919 missense probably damaging 0.98
X0050:Galnt7 UTSW 8 57552444 frame shift probably null
X0062:Galnt7 UTSW 8 57583908 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GACTCTGTCCTGCGATTCCG -3'
(R):5'- TAAAGCCGAGGGGAGTTCCG -3'

Sequencing Primer
(F):5'- TTGGAGCGGCCGCCTATAG -3'
(R):5'- CGAGGGGAGTTCCGGATCTG -3'
Posted On2018-08-01