Incidental Mutation 'R6752:Zfp599'
ID530834
Institutional Source Beutler Lab
Gene Symbol Zfp599
Ensembl Gene ENSMUSG00000062794
Gene Namezinc finger protein 599
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R6752 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location22247430-22259895 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 22249544 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 442 (H442Y)
Ref Sequence ENSEMBL: ENSMUSP00000083462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086281]
Predicted Effect probably damaging
Transcript: ENSMUST00000086281
AA Change: H442Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083462
Gene: ENSMUSG00000062794
AA Change: H442Y

DomainStartEndE-ValueType
KRAB 4 64 5.35e-33 SMART
ZnF_C2H2 228 250 5.59e-4 SMART
ZnF_C2H2 256 278 2.43e-4 SMART
ZnF_C2H2 284 306 1.69e-3 SMART
ZnF_C2H2 312 334 8.94e-3 SMART
ZnF_C2H2 340 362 8.47e-4 SMART
ZnF_C2H2 368 390 5.06e-2 SMART
ZnF_C2H2 396 418 7.9e-4 SMART
ZnF_C2H2 424 446 7.67e-2 SMART
ZnF_C2H2 452 474 1.64e-1 SMART
ZnF_C2H2 480 503 7.37e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,195,483 L45S probably benign Het
Agbl2 G A 2: 90,803,074 C518Y probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Aox1 T C 1: 58,047,239 I101T probably benign Het
Arhgap23 T C 11: 97,452,248 F241S probably damaging Het
Asmt A G X: 170,676,361 M202V probably benign Het
Atp6v0a2 A G 5: 124,641,514 E189G probably damaging Het
Birc3 G A 9: 7,857,344 A376V probably benign Het
Ccbe1 C T 18: 66,076,307 probably null Het
Chst2 C A 9: 95,404,749 E515* probably null Het
Col12a1 A T 9: 79,633,424 N2426K possibly damaging Het
Dmrt2 A G 19: 25,678,342 N435S probably damaging Het
Dnah14 A G 1: 181,593,452 K123E probably benign Het
Dock4 T A 12: 40,820,617 L1452Q probably damaging Het
Galnt7 G A 8: 57,652,951 R10C probably damaging Het
Gm16506 A G 14: 43,727,419 I22T unknown Het
H2-Q6 A G 17: 35,428,127 T292A probably damaging Het
Ifne A G 4: 88,880,082 M33T probably benign Het
Igf2r G A 17: 12,714,944 R808W probably damaging Het
Igfbp5 T C 1: 72,863,909 E169G probably damaging Het
Inppl1 G A 7: 101,832,542 R198* probably null Het
Irgm1 T C 11: 48,866,463 T174A probably damaging Het
Itih3 C T 14: 30,923,489 G21S possibly damaging Het
Klra4 G T 6: 130,062,028 Q134K probably benign Het
Mfsd1 T A 3: 67,596,603 Y309* probably null Het
Mrps10 A G 17: 47,377,815 N162S probably damaging Het
Mtmr14 T C 6: 113,240,397 F90S probably damaging Het
Myh15 A G 16: 49,182,927 D1783G probably damaging Het
Myo3b A G 2: 70,289,512 E972G probably damaging Het
Myt1 G T 2: 181,801,082 V455F probably damaging Het
Nbea T A 3: 55,968,309 T1647S probably benign Het
Nbea A T 3: 56,037,219 S575T probably benign Het
Ntn4 A G 10: 93,734,175 N466S probably benign Het
Olfr1113 A G 2: 87,213,044 M51V probably benign Het
Olfr1468-ps1 T A 19: 13,375,526 L188H unknown Het
Olfr197 T A 16: 59,186,331 N51Y probably damaging Het
Pcdhgb4 T A 18: 37,720,651 I33N probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pom121l2 T G 13: 21,981,769 F70C probably damaging Het
Psmb5 T C 14: 54,616,755 T89A probably benign Het
Rab11fip2 T C 19: 59,907,043 D471G probably damaging Het
Rnh1 A G 7: 141,163,441 V207A probably benign Het
Sh3tc2 C A 18: 61,961,037 T49N probably benign Het
Skint4 T C 4: 112,119,863 M158T possibly damaging Het
Skint7 T A 4: 111,980,266 H80Q probably benign Het
Smg1 A G 7: 118,163,316 probably benign Het
Sostdc1 T C 12: 36,314,412 V40A probably benign Het
Sptlc1 C A 13: 53,335,358 K437N possibly damaging Het
Stat2 T C 10: 128,283,753 F503L probably damaging Het
Syt16 A T 12: 74,229,213 probably null Het
Tspyl1 T C 10: 34,282,587 S103P probably benign Het
Ube4a A T 9: 44,925,948 S1053R probably damaging Het
Vipr1 A G 9: 121,653,893 N58S probably damaging Het
Zfp184 C A 13: 21,959,408 A428E probably damaging Het
Zfp292 A C 4: 34,808,593 F1484V possibly damaging Het
Zfp944 G A 17: 22,339,519 T249I probably benign Het
Zkscan14 T A 5: 145,195,506 H405L probably damaging Het
Other mutations in Zfp599
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Zfp599 APN 9 22249472 missense possibly damaging 0.94
IGL00845:Zfp599 APN 9 22251518 splice site probably benign
R0136:Zfp599 UTSW 9 22249742 missense probably benign 0.13
R0239:Zfp599 UTSW 9 22249759 missense probably damaging 1.00
R0239:Zfp599 UTSW 9 22249759 missense probably damaging 1.00
R0421:Zfp599 UTSW 9 22250547 splice site probably benign
R1699:Zfp599 UTSW 9 22250404 missense probably benign 0.20
R1723:Zfp599 UTSW 9 22258065 missense probably damaging 1.00
R1899:Zfp599 UTSW 9 22251549 missense probably benign 0.00
R4231:Zfp599 UTSW 9 22249745 nonsense probably null
R4233:Zfp599 UTSW 9 22249745 nonsense probably null
R4236:Zfp599 UTSW 9 22249745 nonsense probably null
R4931:Zfp599 UTSW 9 22258123 missense probably damaging 0.98
R5117:Zfp599 UTSW 9 22250100 nonsense probably null
R5615:Zfp599 UTSW 9 22253869 missense probably benign
R5759:Zfp599 UTSW 9 22249661 missense probably damaging 1.00
R5915:Zfp599 UTSW 9 22249834 missense probably damaging 1.00
R6184:Zfp599 UTSW 9 22249651 missense probably benign 0.18
R6188:Zfp599 UTSW 9 22249990 missense probably damaging 1.00
R6657:Zfp599 UTSW 9 22250242 missense probably damaging 1.00
R6736:Zfp599 UTSW 9 22249844 missense probably damaging 1.00
R7071:Zfp599 UTSW 9 22258096 missense probably benign 0.38
R7643:Zfp599 UTSW 9 22249892 missense probably benign 0.19
R7714:Zfp599 UTSW 9 22250515 missense probably benign 0.07
R7951:Zfp599 UTSW 9 22249468 missense probably damaging 1.00
R7967:Zfp599 UTSW 9 22249534 missense possibly damaging 0.66
R8014:Zfp599 UTSW 9 22249481 missense probably benign 0.03
R8187:Zfp599 UTSW 9 22249815 nonsense probably null
RF005:Zfp599 UTSW 9 22253884 missense probably benign 0.03
RF024:Zfp599 UTSW 9 22253884 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACTTTGATGTCGAATGAGGTGTGAC -3'
(R):5'- CTGCTCTCAGGGAAAACTTACTC -3'

Sequencing Primer
(F):5'- CGAATGAGGTGTGACTTTCGG -3'
(R):5'- GAGAAATCCTTTTACTGCCAGTCGG -3'
Posted On2018-08-01