Incidental Mutation 'R6752:Ntn4'
ID 530840
Institutional Source Beutler Lab
Gene Symbol Ntn4
Ensembl Gene ENSMUSG00000020019
Gene Name netrin 4
Synonyms beta-netrin
MMRRC Submission 044869-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6752 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 93476911-93581834 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 93570037 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 466 (N466S)
Ref Sequence ENSEMBL: ENSMUSP00000020204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020204]
AlphaFold Q9JI33
Predicted Effect probably benign
Transcript: ENSMUST00000020204
AA Change: N466S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020204
Gene: ENSMUSG00000020019
AA Change: N466S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 28 260 6.48e-55 SMART
EGF_Lam 262 329 5.83e-7 SMART
EGF_Lam 332 392 3.32e-11 SMART
EGF_Lam 395 446 3.73e-14 SMART
C345C 516 625 5.58e-25 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the netrin family of proteins, which function in various biological processes including axon guidance, tumorogenesis, and angiogenesis. Netrins are laminin-related proteins that have an N-terminal laminin-type domain, epidermal growth factor-like repeat domain, and a positively charged heparin-binding domain at the C-terminus. The protein encoded by this gene is involved in processes including neurite growth and migration, angiogenesis and mural cell adhesion to endothelial cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cell proliferation in the cornea without an increase in corneal thickness and increased microvessel branching in the middle levels of the retina. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,086,309 (GRCm39) L45S probably benign Het
Agbl2 G A 2: 90,633,418 (GRCm39) C518Y probably damaging Het
Akt3 A T 1: 176,877,756 (GRCm39) Y337* probably null Het
Aox1 T C 1: 58,086,398 (GRCm39) I101T probably benign Het
Arhgap23 T C 11: 97,343,074 (GRCm39) F241S probably damaging Het
Asmt A G X: 169,110,096 (GRCm39) M202V probably benign Het
Atp6v0a2 A G 5: 124,779,452 (GRCm39) E189G probably damaging Het
Birc2 G A 9: 7,857,345 (GRCm39) A376V probably benign Het
Ccbe1 C T 18: 66,209,378 (GRCm39) probably null Het
Chst2 C A 9: 95,286,802 (GRCm39) E515* probably null Het
Col12a1 A T 9: 79,540,706 (GRCm39) N2426K possibly damaging Het
Dmrt2 A G 19: 25,655,706 (GRCm39) N435S probably damaging Het
Dnah14 A G 1: 181,421,017 (GRCm39) K123E probably benign Het
Dock4 T A 12: 40,870,616 (GRCm39) L1452Q probably damaging Het
Galnt7 G A 8: 58,105,985 (GRCm39) R10C probably damaging Het
Gm16506 A G 14: 43,964,876 (GRCm39) I22T unknown Het
H2-Q6 A G 17: 35,647,103 (GRCm39) T292A probably damaging Het
Ifne A G 4: 88,798,319 (GRCm39) M33T probably benign Het
Igf2r G A 17: 12,933,831 (GRCm39) R808W probably damaging Het
Igfbp5 T C 1: 72,903,068 (GRCm39) E169G probably damaging Het
Inppl1 G A 7: 101,481,749 (GRCm39) R198* probably null Het
Irgm1 T C 11: 48,757,290 (GRCm39) T174A probably damaging Het
Itih3 C T 14: 30,645,446 (GRCm39) G21S possibly damaging Het
Klra4 G T 6: 130,038,991 (GRCm39) Q134K probably benign Het
Mfsd1 T A 3: 67,503,936 (GRCm39) Y309* probably null Het
Mrps10 A G 17: 47,688,740 (GRCm39) N162S probably damaging Het
Mtmr14 T C 6: 113,217,358 (GRCm39) F90S probably damaging Het
Myh15 A G 16: 49,003,290 (GRCm39) D1783G probably damaging Het
Myo3b A G 2: 70,119,856 (GRCm39) E972G probably damaging Het
Myt1 G T 2: 181,442,875 (GRCm39) V455F probably damaging Het
Nbea A T 3: 55,944,640 (GRCm39) S575T probably benign Het
Nbea T A 3: 55,875,730 (GRCm39) T1647S probably benign Het
Or10ag52 A G 2: 87,043,388 (GRCm39) M51V probably benign Het
Or5b114-ps1 T A 19: 13,352,890 (GRCm39) L188H unknown Het
Or5h27 T A 16: 59,006,694 (GRCm39) N51Y probably damaging Het
Pcdhgb4 T A 18: 37,853,704 (GRCm39) I33N probably damaging Het
Pi4ka A G 16: 17,194,846 (GRCm39) L184P possibly damaging Het
Pom121l2 T G 13: 22,165,939 (GRCm39) F70C probably damaging Het
Psmb5 T C 14: 54,854,212 (GRCm39) T89A probably benign Het
Rab11fip2 T C 19: 59,895,475 (GRCm39) D471G probably damaging Het
Rnh1 A G 7: 140,743,354 (GRCm39) V207A probably benign Het
Sh3tc2 C A 18: 62,094,108 (GRCm39) T49N probably benign Het
Skint4 T C 4: 111,977,060 (GRCm39) M158T possibly damaging Het
Skint7 T A 4: 111,837,463 (GRCm39) H80Q probably benign Het
Smg1 A G 7: 117,762,539 (GRCm39) probably benign Het
Sostdc1 T C 12: 36,364,411 (GRCm39) V40A probably benign Het
Sptlc1 C A 13: 53,489,394 (GRCm39) K437N possibly damaging Het
Stat2 T C 10: 128,119,622 (GRCm39) F503L probably damaging Het
Syt16 A T 12: 74,275,987 (GRCm39) probably null Het
Tspyl1 T C 10: 34,158,583 (GRCm39) S103P probably benign Het
Ube4a A T 9: 44,837,246 (GRCm39) S1053R probably damaging Het
Vipr1 A G 9: 121,482,959 (GRCm39) N58S probably damaging Het
Zfp184 C A 13: 22,143,578 (GRCm39) A428E probably damaging Het
Zfp292 A C 4: 34,808,593 (GRCm39) F1484V possibly damaging Het
Zfp599 G A 9: 22,160,840 (GRCm39) H442Y probably damaging Het
Zfp944 G A 17: 22,558,500 (GRCm39) T249I probably benign Het
Zkscan14 T A 5: 145,132,316 (GRCm39) H405L probably damaging Het
Other mutations in Ntn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02052:Ntn4 APN 10 93,543,211 (GRCm39) missense probably damaging 1.00
IGL02212:Ntn4 APN 10 93,480,711 (GRCm39) missense possibly damaging 0.50
IGL02698:Ntn4 APN 10 93,480,521 (GRCm39) missense probably benign 0.19
IGL02752:Ntn4 APN 10 93,546,421 (GRCm39) missense possibly damaging 0.84
PIT4468001:Ntn4 UTSW 10 93,480,587 (GRCm39) missense probably damaging 0.99
R0131:Ntn4 UTSW 10 93,480,569 (GRCm39) missense possibly damaging 0.89
R0131:Ntn4 UTSW 10 93,480,569 (GRCm39) missense possibly damaging 0.89
R0132:Ntn4 UTSW 10 93,480,569 (GRCm39) missense possibly damaging 0.89
R0419:Ntn4 UTSW 10 93,518,291 (GRCm39) missense probably benign 0.04
R1304:Ntn4 UTSW 10 93,543,215 (GRCm39) missense probably damaging 0.99
R1306:Ntn4 UTSW 10 93,543,215 (GRCm39) missense probably damaging 0.99
R1307:Ntn4 UTSW 10 93,543,215 (GRCm39) missense probably damaging 0.99
R1308:Ntn4 UTSW 10 93,543,215 (GRCm39) missense probably damaging 0.99
R1619:Ntn4 UTSW 10 93,480,596 (GRCm39) missense probably damaging 1.00
R1645:Ntn4 UTSW 10 93,543,215 (GRCm39) missense probably damaging 0.99
R1664:Ntn4 UTSW 10 93,543,215 (GRCm39) missense probably damaging 0.99
R1695:Ntn4 UTSW 10 93,569,464 (GRCm39) splice site probably null
R1796:Ntn4 UTSW 10 93,581,633 (GRCm39) missense probably damaging 1.00
R1806:Ntn4 UTSW 10 93,543,215 (GRCm39) missense probably damaging 0.99
R1845:Ntn4 UTSW 10 93,543,215 (GRCm39) missense probably damaging 0.99
R1856:Ntn4 UTSW 10 93,543,215 (GRCm39) missense probably damaging 0.99
R1872:Ntn4 UTSW 10 93,543,215 (GRCm39) missense probably damaging 0.99
R1879:Ntn4 UTSW 10 93,543,215 (GRCm39) missense probably damaging 0.99
R1901:Ntn4 UTSW 10 93,543,234 (GRCm39) missense possibly damaging 0.93
R1902:Ntn4 UTSW 10 93,543,234 (GRCm39) missense possibly damaging 0.93
R1925:Ntn4 UTSW 10 93,543,215 (GRCm39) missense probably damaging 0.99
R1926:Ntn4 UTSW 10 93,543,215 (GRCm39) missense probably damaging 0.99
R1927:Ntn4 UTSW 10 93,543,215 (GRCm39) missense probably damaging 0.99
R2060:Ntn4 UTSW 10 93,543,215 (GRCm39) missense probably damaging 0.99
R2113:Ntn4 UTSW 10 93,480,701 (GRCm39) missense probably damaging 1.00
R2202:Ntn4 UTSW 10 93,543,215 (GRCm39) missense probably damaging 0.99
R2203:Ntn4 UTSW 10 93,543,215 (GRCm39) missense probably damaging 0.99
R2975:Ntn4 UTSW 10 93,480,753 (GRCm39) missense probably damaging 1.00
R4277:Ntn4 UTSW 10 93,577,072 (GRCm39) missense possibly damaging 0.95
R4805:Ntn4 UTSW 10 93,480,362 (GRCm39) missense probably damaging 0.99
R4806:Ntn4 UTSW 10 93,480,362 (GRCm39) missense probably damaging 0.99
R4807:Ntn4 UTSW 10 93,480,362 (GRCm39) missense probably damaging 0.99
R5818:Ntn4 UTSW 10 93,480,626 (GRCm39) missense probably benign 0.40
R6048:Ntn4 UTSW 10 93,543,128 (GRCm39) splice site probably null
R6051:Ntn4 UTSW 10 93,581,657 (GRCm39) missense probably benign
R6346:Ntn4 UTSW 10 93,480,723 (GRCm39) missense probably damaging 1.00
R7196:Ntn4 UTSW 10 93,569,576 (GRCm39) missense probably benign 0.01
R7240:Ntn4 UTSW 10 93,581,603 (GRCm39) missense probably damaging 0.99
R7365:Ntn4 UTSW 10 93,480,666 (GRCm39) missense probably damaging 1.00
R7374:Ntn4 UTSW 10 93,518,434 (GRCm39) missense probably benign
R7505:Ntn4 UTSW 10 93,543,146 (GRCm39) missense probably damaging 1.00
R7509:Ntn4 UTSW 10 93,546,430 (GRCm39) missense probably benign 0.01
R7726:Ntn4 UTSW 10 93,569,544 (GRCm39) missense possibly damaging 0.82
R7957:Ntn4 UTSW 10 93,480,335 (GRCm39) splice site probably benign
R8092:Ntn4 UTSW 10 93,576,918 (GRCm39) missense probably damaging 0.97
R8202:Ntn4 UTSW 10 93,480,765 (GRCm39) missense possibly damaging 0.88
R8508:Ntn4 UTSW 10 93,576,966 (GRCm39) missense possibly damaging 0.48
R9008:Ntn4 UTSW 10 93,569,466 (GRCm39) splice site probably benign
R9010:Ntn4 UTSW 10 93,480,506 (GRCm39) missense
R9115:Ntn4 UTSW 10 93,569,675 (GRCm39) missense probably benign
R9415:Ntn4 UTSW 10 93,480,488 (GRCm39) missense probably benign 0.00
RF045:Ntn4 UTSW 10 93,546,487 (GRCm39) missense possibly damaging 0.95
X0024:Ntn4 UTSW 10 93,480,833 (GRCm39) missense probably damaging 1.00
Z1176:Ntn4 UTSW 10 93,577,015 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGATCGCCTAATTCATTTTGC -3'
(R):5'- GGCCCTCAGAAGATTCAGAAAG -3'

Sequencing Primer
(F):5'- TCGCCTAATTCATTTTGCAAAATAG -3'
(R):5'- GATTCAGAAAGCTGTCCCCTG -3'
Posted On 2018-08-01