Incidental Mutation 'R6752:Ntn4'
ID530840
Institutional Source Beutler Lab
Gene Symbol Ntn4
Ensembl Gene ENSMUSG00000020019
Gene Namenetrin 4
Synonymsbeta-netrin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6752 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location93640681-93747207 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93734175 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 466 (N466S)
Ref Sequence ENSEMBL: ENSMUSP00000020204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020204]
Predicted Effect probably benign
Transcript: ENSMUST00000020204
AA Change: N466S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020204
Gene: ENSMUSG00000020019
AA Change: N466S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 28 260 6.48e-55 SMART
EGF_Lam 262 329 5.83e-7 SMART
EGF_Lam 332 392 3.32e-11 SMART
EGF_Lam 395 446 3.73e-14 SMART
C345C 516 625 5.58e-25 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the netrin family of proteins, which function in various biological processes including axon guidance, tumorogenesis, and angiogenesis. Netrins are laminin-related proteins that have an N-terminal laminin-type domain, epidermal growth factor-like repeat domain, and a positively charged heparin-binding domain at the C-terminus. The protein encoded by this gene is involved in processes including neurite growth and migration, angiogenesis and mural cell adhesion to endothelial cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cell proliferation in the cornea without an increase in corneal thickness and increased microvessel branching in the middle levels of the retina. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,195,483 L45S probably benign Het
Agbl2 G A 2: 90,803,074 C518Y probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Aox1 T C 1: 58,047,239 I101T probably benign Het
Arhgap23 T C 11: 97,452,248 F241S probably damaging Het
Asmt A G X: 170,676,361 M202V probably benign Het
Atp6v0a2 A G 5: 124,641,514 E189G probably damaging Het
Birc3 G A 9: 7,857,344 A376V probably benign Het
Ccbe1 C T 18: 66,076,307 probably null Het
Chst2 C A 9: 95,404,749 E515* probably null Het
Col12a1 A T 9: 79,633,424 N2426K possibly damaging Het
Dmrt2 A G 19: 25,678,342 N435S probably damaging Het
Dnah14 A G 1: 181,593,452 K123E probably benign Het
Dock4 T A 12: 40,820,617 L1452Q probably damaging Het
Galnt7 G A 8: 57,652,951 R10C probably damaging Het
Gm16506 A G 14: 43,727,419 I22T unknown Het
H2-Q6 A G 17: 35,428,127 T292A probably damaging Het
Ifne A G 4: 88,880,082 M33T probably benign Het
Igf2r G A 17: 12,714,944 R808W probably damaging Het
Igfbp5 T C 1: 72,863,909 E169G probably damaging Het
Inppl1 G A 7: 101,832,542 R198* probably null Het
Irgm1 T C 11: 48,866,463 T174A probably damaging Het
Itih3 C T 14: 30,923,489 G21S possibly damaging Het
Klra4 G T 6: 130,062,028 Q134K probably benign Het
Mfsd1 T A 3: 67,596,603 Y309* probably null Het
Mrps10 A G 17: 47,377,815 N162S probably damaging Het
Mtmr14 T C 6: 113,240,397 F90S probably damaging Het
Myh15 A G 16: 49,182,927 D1783G probably damaging Het
Myo3b A G 2: 70,289,512 E972G probably damaging Het
Myt1 G T 2: 181,801,082 V455F probably damaging Het
Nbea T A 3: 55,968,309 T1647S probably benign Het
Nbea A T 3: 56,037,219 S575T probably benign Het
Olfr1113 A G 2: 87,213,044 M51V probably benign Het
Olfr1468-ps1 T A 19: 13,375,526 L188H unknown Het
Olfr197 T A 16: 59,186,331 N51Y probably damaging Het
Pcdhgb4 T A 18: 37,720,651 I33N probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pom121l2 T G 13: 21,981,769 F70C probably damaging Het
Psmb5 T C 14: 54,616,755 T89A probably benign Het
Rab11fip2 T C 19: 59,907,043 D471G probably damaging Het
Rnh1 A G 7: 141,163,441 V207A probably benign Het
Sh3tc2 C A 18: 61,961,037 T49N probably benign Het
Skint4 T C 4: 112,119,863 M158T possibly damaging Het
Skint7 T A 4: 111,980,266 H80Q probably benign Het
Smg1 A G 7: 118,163,316 probably benign Het
Sostdc1 T C 12: 36,314,412 V40A probably benign Het
Sptlc1 C A 13: 53,335,358 K437N possibly damaging Het
Stat2 T C 10: 128,283,753 F503L probably damaging Het
Syt16 A T 12: 74,229,213 probably null Het
Tspyl1 T C 10: 34,282,587 S103P probably benign Het
Ube4a A T 9: 44,925,948 S1053R probably damaging Het
Vipr1 A G 9: 121,653,893 N58S probably damaging Het
Zfp184 C A 13: 21,959,408 A428E probably damaging Het
Zfp292 A C 4: 34,808,593 F1484V possibly damaging Het
Zfp599 G A 9: 22,249,544 H442Y probably damaging Het
Zfp944 G A 17: 22,339,519 T249I probably benign Het
Zkscan14 T A 5: 145,195,506 H405L probably damaging Het
Other mutations in Ntn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02052:Ntn4 APN 10 93707349 missense probably damaging 1.00
IGL02212:Ntn4 APN 10 93644849 missense possibly damaging 0.50
IGL02698:Ntn4 APN 10 93644659 missense probably benign 0.19
IGL02752:Ntn4 APN 10 93710559 missense possibly damaging 0.84
PIT4468001:Ntn4 UTSW 10 93644725 missense probably damaging 0.99
R0131:Ntn4 UTSW 10 93644707 missense possibly damaging 0.89
R0131:Ntn4 UTSW 10 93644707 missense possibly damaging 0.89
R0132:Ntn4 UTSW 10 93644707 missense possibly damaging 0.89
R0419:Ntn4 UTSW 10 93682429 missense probably benign 0.04
R1304:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1306:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1307:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1308:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1619:Ntn4 UTSW 10 93644734 missense probably damaging 1.00
R1645:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1664:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1695:Ntn4 UTSW 10 93733602 splice site probably null
R1796:Ntn4 UTSW 10 93745771 missense probably damaging 1.00
R1806:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1845:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1856:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1872:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1879:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1901:Ntn4 UTSW 10 93707372 missense possibly damaging 0.93
R1902:Ntn4 UTSW 10 93707372 missense possibly damaging 0.93
R1925:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1926:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1927:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2060:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2113:Ntn4 UTSW 10 93644839 missense probably damaging 1.00
R2202:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2203:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2975:Ntn4 UTSW 10 93644891 missense probably damaging 1.00
R4277:Ntn4 UTSW 10 93741210 missense possibly damaging 0.95
R4805:Ntn4 UTSW 10 93644500 missense probably damaging 0.99
R4806:Ntn4 UTSW 10 93644500 missense probably damaging 0.99
R4807:Ntn4 UTSW 10 93644500 missense probably damaging 0.99
R5818:Ntn4 UTSW 10 93644764 missense probably benign 0.40
R6048:Ntn4 UTSW 10 93707266 splice site probably null
R6051:Ntn4 UTSW 10 93745795 missense probably benign
R6346:Ntn4 UTSW 10 93644861 missense probably damaging 1.00
R7196:Ntn4 UTSW 10 93733714 missense probably benign 0.01
R7240:Ntn4 UTSW 10 93745741 missense probably damaging 0.99
R7365:Ntn4 UTSW 10 93644804 missense probably damaging 1.00
R7374:Ntn4 UTSW 10 93682572 missense probably benign
R7505:Ntn4 UTSW 10 93707284 missense probably damaging 1.00
R7509:Ntn4 UTSW 10 93710568 missense probably benign 0.01
R7726:Ntn4 UTSW 10 93733682 missense possibly damaging 0.82
R7957:Ntn4 UTSW 10 93644473 splice site probably benign
R8092:Ntn4 UTSW 10 93741056 missense probably damaging 0.97
R8202:Ntn4 UTSW 10 93644903 missense possibly damaging 0.88
R8508:Ntn4 UTSW 10 93741104 missense possibly damaging 0.48
RF045:Ntn4 UTSW 10 93710625 missense possibly damaging 0.95
X0024:Ntn4 UTSW 10 93644971 missense probably damaging 1.00
Z1176:Ntn4 UTSW 10 93741153 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGATCGCCTAATTCATTTTGC -3'
(R):5'- GGCCCTCAGAAGATTCAGAAAG -3'

Sequencing Primer
(F):5'- TCGCCTAATTCATTTTGCAAAATAG -3'
(R):5'- GATTCAGAAAGCTGTCCCCTG -3'
Posted On2018-08-01