Incidental Mutation 'R6752:Sostdc1'
ID530845
Institutional Source Beutler Lab
Gene Symbol Sostdc1
Ensembl Gene ENSMUSG00000036169
Gene Namesclerostin domain containing 1
Synonymsectodin, Wise, Sostl, USAG-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.526) question?
Stock #R6752 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location36314139-36318452 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36314412 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 40 (V40A)
Ref Sequence ENSEMBL: ENSMUSP00000040230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041407]
Predicted Effect probably benign
Transcript: ENSMUST00000041407
AA Change: V40A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000040230
Gene: ENSMUSG00000036169
AA Change: V40A

DomainStartEndE-ValueType
Pfam:Sclerostin 6 206 2.1e-112 PFAM
Pfam:DAN 47 168 3.2e-17 PFAM
Pfam:Cys_knot 72 185 1.2e-7 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the sclerostin family and encodes an N-glycosylated, secreted protein with a C-terminal cystine knot-like domain. This protein functions as a bone morphogenetic protein (BMP) antagonist. Specifically, it directly associates with BMPs, prohibiting them from binding their receptors, thereby regulating BMP signaling during cellular proliferation, differentiation, and programmed cell death. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene cause variable defects in many aspects of tooth development, including tooth number, size and cusp pattern. Observed phenotypes may include cranial and palatal defects, neonatal death, altered trigeminal ganglion morphology, and resistance to cisplatin-induced renal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,195,483 L45S probably benign Het
Agbl2 G A 2: 90,803,074 C518Y probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Aox1 T C 1: 58,047,239 I101T probably benign Het
Arhgap23 T C 11: 97,452,248 F241S probably damaging Het
Asmt A G X: 170,676,361 M202V probably benign Het
Atp6v0a2 A G 5: 124,641,514 E189G probably damaging Het
Birc3 G A 9: 7,857,344 A376V probably benign Het
Ccbe1 C T 18: 66,076,307 probably null Het
Chst2 C A 9: 95,404,749 E515* probably null Het
Col12a1 A T 9: 79,633,424 N2426K possibly damaging Het
Dmrt2 A G 19: 25,678,342 N435S probably damaging Het
Dnah14 A G 1: 181,593,452 K123E probably benign Het
Dock4 T A 12: 40,820,617 L1452Q probably damaging Het
Galnt7 G A 8: 57,652,951 R10C probably damaging Het
Gm16506 A G 14: 43,727,419 I22T unknown Het
H2-Q6 A G 17: 35,428,127 T292A probably damaging Het
Ifne A G 4: 88,880,082 M33T probably benign Het
Igf2r G A 17: 12,714,944 R808W probably damaging Het
Igfbp5 T C 1: 72,863,909 E169G probably damaging Het
Inppl1 G A 7: 101,832,542 R198* probably null Het
Irgm1 T C 11: 48,866,463 T174A probably damaging Het
Itih3 C T 14: 30,923,489 G21S possibly damaging Het
Klra4 G T 6: 130,062,028 Q134K probably benign Het
Mfsd1 T A 3: 67,596,603 Y309* probably null Het
Mrps10 A G 17: 47,377,815 N162S probably damaging Het
Mtmr14 T C 6: 113,240,397 F90S probably damaging Het
Myh15 A G 16: 49,182,927 D1783G probably damaging Het
Myo3b A G 2: 70,289,512 E972G probably damaging Het
Myt1 G T 2: 181,801,082 V455F probably damaging Het
Nbea T A 3: 55,968,309 T1647S probably benign Het
Nbea A T 3: 56,037,219 S575T probably benign Het
Ntn4 A G 10: 93,734,175 N466S probably benign Het
Olfr1113 A G 2: 87,213,044 M51V probably benign Het
Olfr1468-ps1 T A 19: 13,375,526 L188H unknown Het
Olfr197 T A 16: 59,186,331 N51Y probably damaging Het
Pcdhgb4 T A 18: 37,720,651 I33N probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pom121l2 T G 13: 21,981,769 F70C probably damaging Het
Psmb5 T C 14: 54,616,755 T89A probably benign Het
Rab11fip2 T C 19: 59,907,043 D471G probably damaging Het
Rnh1 A G 7: 141,163,441 V207A probably benign Het
Sh3tc2 C A 18: 61,961,037 T49N probably benign Het
Skint4 T C 4: 112,119,863 M158T possibly damaging Het
Skint7 T A 4: 111,980,266 H80Q probably benign Het
Smg1 A G 7: 118,163,316 probably benign Het
Sptlc1 C A 13: 53,335,358 K437N possibly damaging Het
Stat2 T C 10: 128,283,753 F503L probably damaging Het
Syt16 A T 12: 74,229,213 probably null Het
Tspyl1 T C 10: 34,282,587 S103P probably benign Het
Ube4a A T 9: 44,925,948 S1053R probably damaging Het
Vipr1 A G 9: 121,653,893 N58S probably damaging Het
Zfp184 C A 13: 21,959,408 A428E probably damaging Het
Zfp292 A C 4: 34,808,593 F1484V possibly damaging Het
Zfp599 G A 9: 22,249,544 H442Y probably damaging Het
Zfp944 G A 17: 22,339,519 T249I probably benign Het
Zkscan14 T A 5: 145,195,506 H405L probably damaging Het
Other mutations in Sostdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01954:Sostdc1 APN 12 36317122 missense probably damaging 1.00
R0588:Sostdc1 UTSW 12 36317021 splice site probably benign
R0671:Sostdc1 UTSW 12 36317341 missense probably damaging 0.99
R2184:Sostdc1 UTSW 12 36317296 missense probably damaging 0.97
R4320:Sostdc1 UTSW 12 36317420 missense probably benign 0.04
R4480:Sostdc1 UTSW 12 36317166 missense probably damaging 0.99
R5511:Sostdc1 UTSW 12 36317166 missense probably damaging 1.00
R5589:Sostdc1 UTSW 12 36317247 nonsense probably null
R5665:Sostdc1 UTSW 12 36314408 missense probably benign 0.39
R6453:Sostdc1 UTSW 12 36314408 missense probably benign 0.39
R7232:Sostdc1 UTSW 12 36317311 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CTTGGGAAGGGATTCCACAGTC -3'
(R):5'- TGCAAAAGCGTAGATGGTTCAC -3'

Sequencing Primer
(F):5'- AGGGATTCCACAGTCCACAGTG -3'
(R):5'- GTGCTACTGAAATGCCTG -3'
Posted On2018-08-01