Incidental Mutation 'R6752:Syt16'
ID530847
Institutional Source Beutler Lab
Gene Symbol Syt16
Ensembl Gene ENSMUSG00000044912
Gene Namesynaptotagmin XVI
SynonymsStrep14, syt14r, Syt14l
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6752 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location73997661-74273267 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 74229213 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110451] [ENSMUST00000221220]
Predicted Effect probably benign
Transcript: ENSMUST00000110451
SMART Domains Protein: ENSMUSP00000106081
Gene: ENSMUSG00000044912

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 70 83 N/A INTRINSIC
C2 270 372 8.91e-4 SMART
low complexity region 386 407 N/A INTRINSIC
C2 425 541 7.07e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189898
Predicted Effect probably null
Transcript: ENSMUST00000221220
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,195,483 L45S probably benign Het
Agbl2 G A 2: 90,803,074 C518Y probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Aox1 T C 1: 58,047,239 I101T probably benign Het
Arhgap23 T C 11: 97,452,248 F241S probably damaging Het
Asmt A G X: 170,676,361 M202V probably benign Het
Atp6v0a2 A G 5: 124,641,514 E189G probably damaging Het
Birc3 G A 9: 7,857,344 A376V probably benign Het
Ccbe1 C T 18: 66,076,307 probably null Het
Chst2 C A 9: 95,404,749 E515* probably null Het
Col12a1 A T 9: 79,633,424 N2426K possibly damaging Het
Dmrt2 A G 19: 25,678,342 N435S probably damaging Het
Dnah14 A G 1: 181,593,452 K123E probably benign Het
Dock4 T A 12: 40,820,617 L1452Q probably damaging Het
Galnt7 G A 8: 57,652,951 R10C probably damaging Het
Gm16506 A G 14: 43,727,419 I22T unknown Het
H2-Q6 A G 17: 35,428,127 T292A probably damaging Het
Ifne A G 4: 88,880,082 M33T probably benign Het
Igf2r G A 17: 12,714,944 R808W probably damaging Het
Igfbp5 T C 1: 72,863,909 E169G probably damaging Het
Inppl1 G A 7: 101,832,542 R198* probably null Het
Irgm1 T C 11: 48,866,463 T174A probably damaging Het
Itih3 C T 14: 30,923,489 G21S possibly damaging Het
Klra4 G T 6: 130,062,028 Q134K probably benign Het
Mfsd1 T A 3: 67,596,603 Y309* probably null Het
Mrps10 A G 17: 47,377,815 N162S probably damaging Het
Mtmr14 T C 6: 113,240,397 F90S probably damaging Het
Myh15 A G 16: 49,182,927 D1783G probably damaging Het
Myo3b A G 2: 70,289,512 E972G probably damaging Het
Myt1 G T 2: 181,801,082 V455F probably damaging Het
Nbea T A 3: 55,968,309 T1647S probably benign Het
Nbea A T 3: 56,037,219 S575T probably benign Het
Ntn4 A G 10: 93,734,175 N466S probably benign Het
Olfr1113 A G 2: 87,213,044 M51V probably benign Het
Olfr1468-ps1 T A 19: 13,375,526 L188H unknown Het
Olfr197 T A 16: 59,186,331 N51Y probably damaging Het
Pcdhgb4 T A 18: 37,720,651 I33N probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pom121l2 T G 13: 21,981,769 F70C probably damaging Het
Psmb5 T C 14: 54,616,755 T89A probably benign Het
Rab11fip2 T C 19: 59,907,043 D471G probably damaging Het
Rnh1 A G 7: 141,163,441 V207A probably benign Het
Sh3tc2 C A 18: 61,961,037 T49N probably benign Het
Skint4 T C 4: 112,119,863 M158T possibly damaging Het
Skint7 T A 4: 111,980,266 H80Q probably benign Het
Smg1 A G 7: 118,163,316 probably benign Het
Sostdc1 T C 12: 36,314,412 V40A probably benign Het
Sptlc1 C A 13: 53,335,358 K437N possibly damaging Het
Stat2 T C 10: 128,283,753 F503L probably damaging Het
Tspyl1 T C 10: 34,282,587 S103P probably benign Het
Ube4a A T 9: 44,925,948 S1053R probably damaging Het
Vipr1 A G 9: 121,653,893 N58S probably damaging Het
Zfp184 C A 13: 21,959,408 A428E probably damaging Het
Zfp292 A C 4: 34,808,593 F1484V possibly damaging Het
Zfp599 G A 9: 22,249,544 H442Y probably damaging Het
Zfp944 G A 17: 22,339,519 T249I probably benign Het
Zkscan14 T A 5: 145,195,506 H405L probably damaging Het
Other mutations in Syt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Syt16 APN 12 74222830 nonsense probably null
IGL01287:Syt16 APN 12 74266739 missense probably damaging 1.00
IGL01401:Syt16 APN 12 74222663 missense possibly damaging 0.66
IGL01780:Syt16 APN 12 74266842 missense probably benign 0.15
IGL02350:Syt16 APN 12 74266842 missense probably benign 0.15
IGL02353:Syt16 APN 12 74129471 missense probably damaging 1.00
IGL02357:Syt16 APN 12 74266842 missense probably benign 0.15
IGL02360:Syt16 APN 12 74129471 missense probably damaging 1.00
IGL02558:Syt16 APN 12 74235058 nonsense probably null
IGL02696:Syt16 APN 12 74129411 missense possibly damaging 0.90
R0701:Syt16 UTSW 12 74235112 missense probably benign 0.01
R1103:Syt16 UTSW 12 74266898 missense probably damaging 1.00
R2002:Syt16 UTSW 12 74235203 missense possibly damaging 0.77
R2079:Syt16 UTSW 12 74238299 missense probably damaging 1.00
R2124:Syt16 UTSW 12 74238235 missense probably damaging 1.00
R3806:Syt16 UTSW 12 74229398 missense possibly damaging 0.93
R3807:Syt16 UTSW 12 74229398 missense possibly damaging 0.93
R4887:Syt16 UTSW 12 74129386 missense probably damaging 0.96
R4889:Syt16 UTSW 12 74129495 missense probably damaging 0.98
R5153:Syt16 UTSW 12 74222768 missense possibly damaging 0.60
R6038:Syt16 UTSW 12 74222535 splice site probably null
R6042:Syt16 UTSW 12 74266730 missense probably damaging 1.00
R6328:Syt16 UTSW 12 74266693 nonsense probably null
R7248:Syt16 UTSW 12 74266709 missense probably damaging 1.00
R7275:Syt16 UTSW 12 74266709 missense probably damaging 1.00
R7276:Syt16 UTSW 12 74266709 missense probably damaging 1.00
Z1177:Syt16 UTSW 12 74222789 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TTAAGGACATGACCCTTGCCTAC -3'
(R):5'- ACAAAAGCTGTCTCCGTCTC -3'

Sequencing Primer
(F):5'- AGGACATGACCCTTGCCTACTTTATC -3'
(R):5'- TCTCCAGGACGCCATCTG -3'
Posted On2018-08-01