Incidental Mutation 'R6752:Zfp184'
ID530848
Institutional Source Beutler Lab
Gene Symbol Zfp184
Ensembl Gene ENSMUSG00000006720
Gene Namezinc finger protein 184 (Kruppel-like)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R6752 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location21945094-21960779 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 21959408 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 428 (A428E)
Ref Sequence ENSEMBL: ENSMUSP00000135173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006903] [ENSMUST00000102978] [ENSMUST00000176511] [ENSMUST00000176580]
Predicted Effect probably damaging
Transcript: ENSMUST00000006903
AA Change: A428E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000006903
Gene: ENSMUSG00000006720
AA Change: A428E

DomainStartEndE-ValueType
KRAB 28 88 1.14e-36 SMART
ZnF_C2H2 201 223 5.42e-2 SMART
ZnF_C2H2 229 251 1.22e-4 SMART
ZnF_C2H2 257 279 2.09e-3 SMART
ZnF_C2H2 285 307 5.29e-5 SMART
ZnF_C2H2 313 335 8.6e-5 SMART
ZnF_C2H2 341 363 1.28e-3 SMART
ZnF_C2H2 369 391 1.12e-3 SMART
ZnF_C2H2 397 419 1.84e-4 SMART
ZnF_C2H2 425 447 2.4e-3 SMART
ZnF_C2H2 453 475 4.79e-3 SMART
ZnF_C2H2 481 503 3.69e-4 SMART
ZnF_C2H2 509 531 7.37e-4 SMART
ZnF_C2H2 537 559 6.88e-4 SMART
ZnF_C2H2 565 587 2.43e-4 SMART
ZnF_C2H2 593 615 2.75e-3 SMART
ZnF_C2H2 621 643 5.99e-4 SMART
ZnF_C2H2 649 671 8.94e-3 SMART
ZnF_C2H2 679 698 4.27e1 SMART
ZnF_C2H2 704 726 1.23e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102978
AA Change: A428E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000100043
Gene: ENSMUSG00000006720
AA Change: A428E

DomainStartEndE-ValueType
KRAB 28 88 1.14e-36 SMART
ZnF_C2H2 201 223 5.42e-2 SMART
ZnF_C2H2 229 251 1.22e-4 SMART
ZnF_C2H2 257 279 2.09e-3 SMART
ZnF_C2H2 285 307 5.29e-5 SMART
ZnF_C2H2 313 335 8.6e-5 SMART
ZnF_C2H2 341 363 1.28e-3 SMART
ZnF_C2H2 369 391 1.12e-3 SMART
ZnF_C2H2 397 419 1.84e-4 SMART
ZnF_C2H2 425 447 2.4e-3 SMART
ZnF_C2H2 453 475 4.79e-3 SMART
ZnF_C2H2 481 503 3.69e-4 SMART
ZnF_C2H2 509 531 7.37e-4 SMART
ZnF_C2H2 537 559 6.88e-4 SMART
ZnF_C2H2 565 587 2.43e-4 SMART
ZnF_C2H2 593 615 2.75e-3 SMART
ZnF_C2H2 621 643 5.99e-4 SMART
ZnF_C2H2 649 671 8.94e-3 SMART
ZnF_C2H2 679 698 4.27e1 SMART
ZnF_C2H2 704 726 1.23e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176003
Predicted Effect probably damaging
Transcript: ENSMUST00000176511
AA Change: A428E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135173
Gene: ENSMUSG00000006720
AA Change: A428E

DomainStartEndE-ValueType
KRAB 28 88 1.14e-36 SMART
ZnF_C2H2 201 223 5.42e-2 SMART
ZnF_C2H2 229 251 1.22e-4 SMART
ZnF_C2H2 257 279 2.09e-3 SMART
ZnF_C2H2 285 307 5.29e-5 SMART
ZnF_C2H2 313 335 8.6e-5 SMART
ZnF_C2H2 341 363 1.28e-3 SMART
ZnF_C2H2 369 391 1.12e-3 SMART
ZnF_C2H2 397 419 1.84e-4 SMART
ZnF_C2H2 425 447 2.4e-3 SMART
ZnF_C2H2 453 475 4.79e-3 SMART
ZnF_C2H2 481 503 3.69e-4 SMART
ZnF_C2H2 509 531 7.37e-4 SMART
ZnF_C2H2 537 559 6.88e-4 SMART
ZnF_C2H2 565 587 2.43e-4 SMART
ZnF_C2H2 593 615 2.75e-3 SMART
ZnF_C2H2 621 643 5.99e-4 SMART
ZnF_C2H2 649 671 8.94e-3 SMART
ZnF_C2H2 679 698 4.27e1 SMART
ZnF_C2H2 704 726 1.23e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176580
SMART Domains Protein: ENSMUSP00000135404
Gene: ENSMUSG00000006720

DomainStartEndE-ValueType
KRAB 28 84 1.96e-17 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted to be a Kruppel C2H2-type zinc-finger protein family member. Sequence analysis predicts that the protein contains two Kruppel associated box (KRAB) boxes in the N-terminus and highly conserved zinc finger motifs at the C-terminus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,195,483 L45S probably benign Het
Agbl2 G A 2: 90,803,074 C518Y probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Aox1 T C 1: 58,047,239 I101T probably benign Het
Arhgap23 T C 11: 97,452,248 F241S probably damaging Het
Asmt A G X: 170,676,361 M202V probably benign Het
Atp6v0a2 A G 5: 124,641,514 E189G probably damaging Het
Birc3 G A 9: 7,857,344 A376V probably benign Het
Ccbe1 C T 18: 66,076,307 probably null Het
Chst2 C A 9: 95,404,749 E515* probably null Het
Col12a1 A T 9: 79,633,424 N2426K possibly damaging Het
Dmrt2 A G 19: 25,678,342 N435S probably damaging Het
Dnah14 A G 1: 181,593,452 K123E probably benign Het
Dock4 T A 12: 40,820,617 L1452Q probably damaging Het
Galnt7 G A 8: 57,652,951 R10C probably damaging Het
Gm16506 A G 14: 43,727,419 I22T unknown Het
H2-Q6 A G 17: 35,428,127 T292A probably damaging Het
Ifne A G 4: 88,880,082 M33T probably benign Het
Igf2r G A 17: 12,714,944 R808W probably damaging Het
Igfbp5 T C 1: 72,863,909 E169G probably damaging Het
Inppl1 G A 7: 101,832,542 R198* probably null Het
Irgm1 T C 11: 48,866,463 T174A probably damaging Het
Itih3 C T 14: 30,923,489 G21S possibly damaging Het
Klra4 G T 6: 130,062,028 Q134K probably benign Het
Mfsd1 T A 3: 67,596,603 Y309* probably null Het
Mrps10 A G 17: 47,377,815 N162S probably damaging Het
Mtmr14 T C 6: 113,240,397 F90S probably damaging Het
Myh15 A G 16: 49,182,927 D1783G probably damaging Het
Myo3b A G 2: 70,289,512 E972G probably damaging Het
Myt1 G T 2: 181,801,082 V455F probably damaging Het
Nbea T A 3: 55,968,309 T1647S probably benign Het
Nbea A T 3: 56,037,219 S575T probably benign Het
Ntn4 A G 10: 93,734,175 N466S probably benign Het
Olfr1113 A G 2: 87,213,044 M51V probably benign Het
Olfr1468-ps1 T A 19: 13,375,526 L188H unknown Het
Olfr197 T A 16: 59,186,331 N51Y probably damaging Het
Pcdhgb4 T A 18: 37,720,651 I33N probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pom121l2 T G 13: 21,981,769 F70C probably damaging Het
Psmb5 T C 14: 54,616,755 T89A probably benign Het
Rab11fip2 T C 19: 59,907,043 D471G probably damaging Het
Rnh1 A G 7: 141,163,441 V207A probably benign Het
Sh3tc2 C A 18: 61,961,037 T49N probably benign Het
Skint4 T C 4: 112,119,863 M158T possibly damaging Het
Skint7 T A 4: 111,980,266 H80Q probably benign Het
Smg1 A G 7: 118,163,316 probably benign Het
Sostdc1 T C 12: 36,314,412 V40A probably benign Het
Sptlc1 C A 13: 53,335,358 K437N possibly damaging Het
Stat2 T C 10: 128,283,753 F503L probably damaging Het
Syt16 A T 12: 74,229,213 probably null Het
Tspyl1 T C 10: 34,282,587 S103P probably benign Het
Ube4a A T 9: 44,925,948 S1053R probably damaging Het
Vipr1 A G 9: 121,653,893 N58S probably damaging Het
Zfp292 A C 4: 34,808,593 F1484V possibly damaging Het
Zfp599 G A 9: 22,249,544 H442Y probably damaging Het
Zfp944 G A 17: 22,339,519 T249I probably benign Het
Zkscan14 T A 5: 145,195,506 H405L probably damaging Het
Other mutations in Zfp184
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01674:Zfp184 APN 13 21950225 splice site probably benign
R0393:Zfp184 UTSW 13 21947082 splice site probably benign
R0636:Zfp184 UTSW 13 21949749 missense probably damaging 1.00
R1657:Zfp184 UTSW 13 21959273 missense probably damaging 1.00
R1718:Zfp184 UTSW 13 21959272 missense possibly damaging 0.76
R4237:Zfp184 UTSW 13 21958778 missense probably damaging 1.00
R4326:Zfp184 UTSW 13 21959902 missense probably damaging 1.00
R4327:Zfp184 UTSW 13 21959902 missense probably damaging 1.00
R4328:Zfp184 UTSW 13 21959902 missense probably damaging 1.00
R4877:Zfp184 UTSW 13 21960328 missense possibly damaging 0.92
R4941:Zfp184 UTSW 13 21949721 missense probably damaging 1.00
R5014:Zfp184 UTSW 13 21958424 missense probably benign 0.37
R5054:Zfp184 UTSW 13 21959282 missense possibly damaging 0.74
R5105:Zfp184 UTSW 13 21959629 missense possibly damaging 0.58
R5216:Zfp184 UTSW 13 21950236 missense probably damaging 1.00
R5379:Zfp184 UTSW 13 21959881 missense probably damaging 1.00
R5387:Zfp184 UTSW 13 21949640 intron probably benign
R5490:Zfp184 UTSW 13 21958577 missense probably benign 0.40
R6220:Zfp184 UTSW 13 21960207 missense probably damaging 1.00
R7088:Zfp184 UTSW 13 21959992 missense probably damaging 1.00
R7653:Zfp184 UTSW 13 21959717 missense probably damaging 1.00
X0057:Zfp184 UTSW 13 21959548 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGATGAATGTGGGAAGGCC -3'
(R):5'- CACACTCACTGCACTCAAAGGG -3'

Sequencing Primer
(F):5'- AGGTCACTTTATGGAGCACC -3'
(R):5'- ACTCAAAGGGCTTCTCTCGG -3'
Posted On2018-08-01