Incidental Mutation 'R6752:Psmb5'
ID530853
Institutional Source Beutler Lab
Gene Symbol Psmb5
Ensembl Gene ENSMUSG00000022193
Gene Nameproteasome (prosome, macropain) subunit, beta type 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R6752 (G1)
Quality Score195.009
Status Validated
Chromosome14
Chromosomal Location54614119-54618022 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54616755 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 89 (T89A)
Ref Sequence ENSEMBL: ENSMUSP00000022803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022803] [ENSMUST00000227257] [ENSMUST00000228446]
PDB Structure
Mouse constitutive 20S proteasome in complex with PR-957 [X-RAY DIFFRACTION]
Mouse constitutive 20S proteasome [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000022803
AA Change: T89A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022803
Gene: ENSMUSG00000022193
AA Change: T89A

DomainStartEndE-ValueType
low complexity region 17 42 N/A INTRINSIC
Pfam:Proteasome 56 238 8.3e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102174
Predicted Effect probably benign
Transcript: ENSMUST00000227257
Predicted Effect probably benign
Transcript: ENSMUST00000228446
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit in the proteasome. This catalytic subunit is not present in the immunoproteasome and is replaced by catalytic subunit 3i (proteasome beta 8 subunit). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,195,483 L45S probably benign Het
Agbl2 G A 2: 90,803,074 C518Y probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Aox1 T C 1: 58,047,239 I101T probably benign Het
Arhgap23 T C 11: 97,452,248 F241S probably damaging Het
Asmt A G X: 170,676,361 M202V probably benign Het
Atp6v0a2 A G 5: 124,641,514 E189G probably damaging Het
Birc3 G A 9: 7,857,344 A376V probably benign Het
Ccbe1 C T 18: 66,076,307 probably null Het
Chst2 C A 9: 95,404,749 E515* probably null Het
Col12a1 A T 9: 79,633,424 N2426K possibly damaging Het
Dmrt2 A G 19: 25,678,342 N435S probably damaging Het
Dnah14 A G 1: 181,593,452 K123E probably benign Het
Dock4 T A 12: 40,820,617 L1452Q probably damaging Het
Galnt7 G A 8: 57,652,951 R10C probably damaging Het
Gm16506 A G 14: 43,727,419 I22T unknown Het
H2-Q6 A G 17: 35,428,127 T292A probably damaging Het
Ifne A G 4: 88,880,082 M33T probably benign Het
Igf2r G A 17: 12,714,944 R808W probably damaging Het
Igfbp5 T C 1: 72,863,909 E169G probably damaging Het
Inppl1 G A 7: 101,832,542 R198* probably null Het
Irgm1 T C 11: 48,866,463 T174A probably damaging Het
Itih3 C T 14: 30,923,489 G21S possibly damaging Het
Klra4 G T 6: 130,062,028 Q134K probably benign Het
Mfsd1 T A 3: 67,596,603 Y309* probably null Het
Mrps10 A G 17: 47,377,815 N162S probably damaging Het
Mtmr14 T C 6: 113,240,397 F90S probably damaging Het
Myh15 A G 16: 49,182,927 D1783G probably damaging Het
Myo3b A G 2: 70,289,512 E972G probably damaging Het
Myt1 G T 2: 181,801,082 V455F probably damaging Het
Nbea T A 3: 55,968,309 T1647S probably benign Het
Nbea A T 3: 56,037,219 S575T probably benign Het
Ntn4 A G 10: 93,734,175 N466S probably benign Het
Olfr1113 A G 2: 87,213,044 M51V probably benign Het
Olfr1468-ps1 T A 19: 13,375,526 L188H unknown Het
Olfr197 T A 16: 59,186,331 N51Y probably damaging Het
Pcdhgb4 T A 18: 37,720,651 I33N probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pom121l2 T G 13: 21,981,769 F70C probably damaging Het
Rab11fip2 T C 19: 59,907,043 D471G probably damaging Het
Rnh1 A G 7: 141,163,441 V207A probably benign Het
Sh3tc2 C A 18: 61,961,037 T49N probably benign Het
Skint4 T C 4: 112,119,863 M158T possibly damaging Het
Skint7 T A 4: 111,980,266 H80Q probably benign Het
Smg1 A G 7: 118,163,316 probably benign Het
Sostdc1 T C 12: 36,314,412 V40A probably benign Het
Sptlc1 C A 13: 53,335,358 K437N possibly damaging Het
Stat2 T C 10: 128,283,753 F503L probably damaging Het
Syt16 A T 12: 74,229,213 probably null Het
Tspyl1 T C 10: 34,282,587 S103P probably benign Het
Ube4a A T 9: 44,925,948 S1053R probably damaging Het
Vipr1 A G 9: 121,653,893 N58S probably damaging Het
Zfp184 C A 13: 21,959,408 A428E probably damaging Het
Zfp292 A C 4: 34,808,593 F1484V possibly damaging Het
Zfp599 G A 9: 22,249,544 H442Y probably damaging Het
Zfp944 G A 17: 22,339,519 T249I probably benign Het
Zkscan14 T A 5: 145,195,506 H405L probably damaging Het
Other mutations in Psmb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Psmb5 APN 14 54617807 missense possibly damaging 0.85
IGL02967:Psmb5 APN 14 54616626 missense probably benign 0.11
IGL03095:Psmb5 APN 14 54616557 missense probably damaging 1.00
R2447:Psmb5 UTSW 14 54614470 missense probably damaging 0.97
R5651:Psmb5 UTSW 14 54616764 missense possibly damaging 0.64
R6346:Psmb5 UTSW 14 54616673 missense probably damaging 0.98
R6372:Psmb5 UTSW 14 54616673 missense probably damaging 0.98
R6657:Psmb5 UTSW 14 54614383 missense possibly damaging 0.61
R6687:Psmb5 UTSW 14 54616673 missense probably damaging 0.98
R6688:Psmb5 UTSW 14 54616673 missense probably damaging 0.98
R7007:Psmb5 UTSW 14 54616709 missense probably damaging 0.99
R7801:Psmb5 UTSW 14 54616755 missense probably benign 0.00
R8066:Psmb5 UTSW 14 54614241 missense probably benign 0.00
R8278:Psmb5 UTSW 14 54617885 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TTATCCCAGCCACAGATCATGG -3'
(R):5'- GATGCAAAGCCAGGTTATCTTTC -3'

Sequencing Primer
(F):5'- GTACTGATACACCATGTTAGCGAGC -3'
(R):5'- GTTTCTCCATGGAGTCATT -3'
Posted On2018-08-01