Mutagenetix > Incidental Mutation

Incidental Mutation 'R6752:Igf2r'

530857

Institutional Source

Beutler Lab

Gene Symbol

Igf2r

Ensembl Gene

ENSMUSG00000023830

Gene Name

insulin-like growth factor 2 receptor

Synonyms

M6P/IGF2R, IGF-II/CI-MPR, Mpr300, CI-MPR, CD222, mannose-6-phosphate receptor, cation independent

MMRRC Submission

044869-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.919) question?

Stock #

R6752 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

12682406-12769664 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 12714944 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 808 (R808W)

Ref Sequence

ENSEMBL: ENSMUSP00000024599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024599]

AlphaFold

Q07113

Predicted Effect

probably damaging
Transcript: ENSMUST00000024599
AA Change: R808W

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: R808W

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
low complexity region	94	104	N/A	INTRINSIC
Pfam:CIMR	118	266	5.1e-21	PFAM
Pfam:CIMR	272	416	8.8e-22	PFAM
Pfam:CIMR	418	567	3.4e-53	PFAM
Pfam:CIMR	569	709	6.5e-47	PFAM
Pfam:CIMR	713	869	6.5e-34	PFAM
Pfam:CIMR	876	1020	1.9e-10	PFAM
Pfam:CIMR	1024	1171	1e-60	PFAM
Pfam:CIMR	1172	1313	1.2e-17	PFAM
Pfam:CIMR	1315	1455	2.1e-58	PFAM
Pfam:CIMR	1458	1592	1.8e-22	PFAM
Pfam:CIMR	1596	1743	9.1e-23	PFAM
Pfam:CIMR	1748	1887	2.5e-22	PFAM
FN2	1889	1935	9.51e-26	SMART
Pfam:CIMR	1939	2076	2.1e-22	PFAM
Pfam:CIMR	2230	2294	4.9e-9	PFAM
transmembrane domain	2295	2317	N/A	INTRINSIC
low complexity region	2336	2363	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	T	C	11: 84,195,483 (GRCm38)	L45S	probably benign	Het
Agbl2	G	A	2: 90,803,074 (GRCm38)	C518Y	probably damaging	Het
Akt3	A	T	1: 177,050,190 (GRCm38)	Y337*	probably null	Het
Aox1	T	C	1: 58,047,239 (GRCm38)	I101T	probably benign	Het
Arhgap23	T	C	11: 97,452,248 (GRCm38)	F241S	probably damaging	Het
Asmt	A	G	X: 170,676,361 (GRCm38)	M202V	probably benign	Het
Atp6v0a2	A	G	5: 124,641,514 (GRCm38)	E189G	probably damaging	Het
Birc3	G	A	9: 7,857,344 (GRCm38)	A376V	probably benign	Het
Ccbe1	C	T	18: 66,076,307 (GRCm38)		probably null	Het
Chst2	C	A	9: 95,404,749 (GRCm38)	E515*	probably null	Het
Col12a1	A	T	9: 79,633,424 (GRCm38)	N2426K	possibly damaging	Het
Dmrt2	A	G	19: 25,678,342 (GRCm38)	N435S	probably damaging	Het
Dnah14	A	G	1: 181,593,452 (GRCm38)	K123E	probably benign	Het
Dock4	T	A	12: 40,820,617 (GRCm38)	L1452Q	probably damaging	Het
Galnt7	G	A	8: 57,652,951 (GRCm38)	R10C	probably damaging	Het
Gm16506	A	G	14: 43,727,419 (GRCm38)	I22T	unknown	Het
H2-Q6	A	G	17: 35,428,127 (GRCm38)	T292A	probably damaging	Het
Ifne	A	G	4: 88,880,082 (GRCm38)	M33T	probably benign	Het
Igfbp5	T	C	1: 72,863,909 (GRCm38)	E169G	probably damaging	Het
Inppl1	G	A	7: 101,832,542 (GRCm38)	R198*	probably null	Het
Irgm1	T	C	11: 48,866,463 (GRCm38)	T174A	probably damaging	Het
Itih3	C	T	14: 30,923,489 (GRCm38)	G21S	possibly damaging	Het
Klra4	G	T	6: 130,062,028 (GRCm38)	Q134K	probably benign	Het
Mfsd1	T	A	3: 67,596,603 (GRCm38)	Y309*	probably null	Het
Mrps10	A	G	17: 47,377,815 (GRCm38)	N162S	probably damaging	Het
Mtmr14	T	C	6: 113,240,397 (GRCm38)	F90S	probably damaging	Het
Myh15	A	G	16: 49,182,927 (GRCm38)	D1783G	probably damaging	Het
Myo3b	A	G	2: 70,289,512 (GRCm38)	E972G	probably damaging	Het
Myt1	G	T	2: 181,801,082 (GRCm38)	V455F	probably damaging	Het
Nbea	A	T	3: 56,037,219 (GRCm38)	S575T	probably benign	Het
Nbea	T	A	3: 55,968,309 (GRCm38)	T1647S	probably benign	Het
Ntn4	A	G	10: 93,734,175 (GRCm38)	N466S	probably benign	Het
Or10ag52	A	G	2: 87,213,044 (GRCm38)	M51V	probably benign	Het
Or5b114-ps1	T	A	19: 13,375,526 (GRCm38)	L188H	unknown	Het
Or5h27	T	A	16: 59,186,331 (GRCm38)	N51Y	probably damaging	Het
Pcdhgb4	T	A	18: 37,720,651 (GRCm38)	I33N	probably damaging	Het
Pi4ka	A	G	16: 17,376,982 (GRCm38)	L184P	possibly damaging	Het
Pom121l2	T	G	13: 21,981,769 (GRCm38)	F70C	probably damaging	Het
Psmb5	T	C	14: 54,616,755 (GRCm38)	T89A	probably benign	Het
Rab11fip2	T	C	19: 59,907,043 (GRCm38)	D471G	probably damaging	Het
Rnh1	A	G	7: 141,163,441 (GRCm38)	V207A	probably benign	Het
Sh3tc2	C	A	18: 61,961,037 (GRCm38)	T49N	probably benign	Het
Skint4	T	C	4: 112,119,863 (GRCm38)	M158T	possibly damaging	Het
Skint7	T	A	4: 111,980,266 (GRCm38)	H80Q	probably benign	Het
Smg1	A	G	7: 118,163,316 (GRCm38)		probably benign	Het
Sostdc1	T	C	12: 36,314,412 (GRCm38)	V40A	probably benign	Het
Sptlc1	C	A	13: 53,335,358 (GRCm38)	K437N	possibly damaging	Het
Stat2	T	C	10: 128,283,753 (GRCm38)	F503L	probably damaging	Het
Syt16	A	T	12: 74,229,213 (GRCm38)		probably null	Het
Tspyl1	T	C	10: 34,282,587 (GRCm38)	S103P	probably benign	Het
Ube4a	A	T	9: 44,925,948 (GRCm38)	S1053R	probably damaging	Het
Vipr1	A	G	9: 121,653,893 (GRCm38)	N58S	probably damaging	Het
Zfp184	C	A	13: 21,959,408 (GRCm38)	A428E	probably damaging	Het
Zfp292	A	C	4: 34,808,593 (GRCm38)	F1484V	possibly damaging	Het
Zfp599	G	A	9: 22,249,544 (GRCm38)	H442Y	probably damaging	Het
Zfp944	G	A	17: 22,339,519 (GRCm38)	T249I	probably benign	Het
Zkscan14	T	A	5: 145,195,506 (GRCm38)	H405L	probably damaging	Het

Other mutations in Igf2r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Igf2r	APN	17	12,713,990 (GRCm38)	missense	probably benign	0.01
IGL00534:Igf2r	APN	17	12,739,328 (GRCm38)	missense	probably damaging	0.97
IGL00902:Igf2r	APN	17	12,700,358 (GRCm38)	missense	probably damaging	0.99
IGL00903:Igf2r	APN	17	12,683,867 (GRCm38)	missense	possibly damaging	0.70
IGL01160:Igf2r	APN	17	12,704,775 (GRCm38)	missense	possibly damaging	0.73
IGL01380:Igf2r	APN	17	12,695,374 (GRCm38)	missense	probably benign	0.01
IGL01392:Igf2r	APN	17	12,704,349 (GRCm38)	missense	probably benign
IGL01557:Igf2r	APN	17	12,704,635 (GRCm38)	missense	possibly damaging	0.82
IGL01568:Igf2r	APN	17	12,683,985 (GRCm38)	missense	possibly damaging	0.93
IGL01611:Igf2r	APN	17	12,725,415 (GRCm38)	nonsense	probably null
IGL01720:Igf2r	APN	17	12,701,313 (GRCm38)	missense	probably damaging	0.99
IGL01756:Igf2r	APN	17	12,683,822 (GRCm38)	missense	probably benign
IGL01839:Igf2r	APN	17	12,705,022 (GRCm38)	missense	probably damaging	1.00
IGL01904:Igf2r	APN	17	12,714,911 (GRCm38)	missense	probably damaging	0.99
IGL01965:Igf2r	APN	17	12,704,338 (GRCm38)	missense	probably benign	0.12
IGL02083:Igf2r	APN	17	12,693,192 (GRCm38)	nonsense	probably null
IGL02095:Igf2r	APN	17	12,702,005 (GRCm38)	missense	probably damaging	0.99
IGL02183:Igf2r	APN	17	12,698,516 (GRCm38)	unclassified	probably benign
IGL02576:Igf2r	APN	17	12,748,763 (GRCm38)	missense	possibly damaging	0.90
IGL02649:Igf2r	APN	17	12,712,087 (GRCm38)	missense	possibly damaging	0.93
IGL02807:Igf2r	APN	17	12,719,883 (GRCm38)	missense	probably damaging	0.98
IGL02833:Igf2r	APN	17	12,692,723 (GRCm38)	missense	probably damaging	0.97
IGL02885:Igf2r	APN	17	12,694,120 (GRCm38)	missense	possibly damaging	0.94
IGL02990:Igf2r	APN	17	12,710,746 (GRCm38)	splice site	probably benign
IGL03080:Igf2r	APN	17	12,726,676 (GRCm38)	missense	probably benign	0.06
IGL03176:Igf2r	APN	17	12,716,672 (GRCm38)	missense	probably damaging	1.00
blunt	UTSW	17	12,722,175 (GRCm38)	missense	probably benign	0.02
brusque	UTSW	17	12,714,951 (GRCm38)	missense	probably damaging	0.98
gruff	UTSW	17	12,684,097 (GRCm38)	missense	probably damaging	0.96
outlier	UTSW	17	12,695,314 (GRCm38)	missense	probably benign	0.20
NA:Igf2r	UTSW	17	12,691,962 (GRCm38)	missense	probably benign
R0165:Igf2r	UTSW	17	12,698,527 (GRCm38)	missense	probably benign	0.07
R0412:Igf2r	UTSW	17	12,683,948 (GRCm38)	missense	probably damaging	0.98
R0523:Igf2r	UTSW	17	12,692,064 (GRCm38)	missense	probably benign	0.27
R0631:Igf2r	UTSW	17	12,717,274 (GRCm38)	splice site	probably null
R0722:Igf2r	UTSW	17	12,715,495 (GRCm38)	critical splice acceptor site	probably null
R0894:Igf2r	UTSW	17	12,692,101 (GRCm38)	missense	probably benign	0.02
R1265:Igf2r	UTSW	17	12,694,124 (GRCm38)	missense	probably damaging	0.98
R1466:Igf2r	UTSW	17	12,717,269 (GRCm38)	splice site	probably benign
R1485:Igf2r	UTSW	17	12,691,285 (GRCm38)	missense	probably damaging	1.00
R1633:Igf2r	UTSW	17	12,726,309 (GRCm38)	missense	probably benign
R1693:Igf2r	UTSW	17	12,704,316 (GRCm38)	missense	probably damaging	0.97
R1751:Igf2r	UTSW	17	12,697,441 (GRCm38)	missense	possibly damaging	0.94
R1843:Igf2r	UTSW	17	12,704,270 (GRCm38)	critical splice donor site	probably null
R1981:Igf2r	UTSW	17	12,733,903 (GRCm38)	nonsense	probably null
R1994:Igf2r	UTSW	17	12,692,738 (GRCm38)	missense	probably benign
R2060:Igf2r	UTSW	17	12,701,319 (GRCm38)	missense	possibly damaging	0.92
R2108:Igf2r	UTSW	17	12,698,251 (GRCm38)	missense	probably benign	0.02
R2132:Igf2r	UTSW	17	12,722,208 (GRCm38)	missense	probably benign	0.12
R2314:Igf2r	UTSW	17	12,715,943 (GRCm38)	missense	probably benign	0.28
R2349:Igf2r	UTSW	17	12,722,311 (GRCm38)	splice site	probably null
R2696:Igf2r	UTSW	17	12,695,344 (GRCm38)	missense	possibly damaging	0.96
R2864:Igf2r	UTSW	17	12,686,724 (GRCm38)	missense	probably damaging	0.99
R2865:Igf2r	UTSW	17	12,686,724 (GRCm38)	missense	probably damaging	0.99
R3884:Igf2r	UTSW	17	12,709,468 (GRCm38)	missense	probably benign
R3930:Igf2r	UTSW	17	12,705,829 (GRCm38)	missense	probably benign	0.01
R4021:Igf2r	UTSW	17	12,748,751 (GRCm38)	missense	probably damaging	0.97
R4125:Igf2r	UTSW	17	12,702,254 (GRCm38)	missense	possibly damaging	0.93
R4342:Igf2r	UTSW	17	12,709,511 (GRCm38)	missense	possibly damaging	0.95
R4343:Igf2r	UTSW	17	12,709,511 (GRCm38)	missense	possibly damaging	0.95
R4345:Igf2r	UTSW	17	12,709,511 (GRCm38)	missense	possibly damaging	0.95
R4760:Igf2r	UTSW	17	12,703,465 (GRCm38)	missense	possibly damaging	0.92
R4796:Igf2r	UTSW	17	12,684,126 (GRCm38)	missense	possibly damaging	0.70
R4816:Igf2r	UTSW	17	12,684,097 (GRCm38)	missense	probably damaging	0.96
R4826:Igf2r	UTSW	17	12,701,353 (GRCm38)	missense	probably damaging	0.98
R4933:Igf2r	UTSW	17	12,691,877 (GRCm38)	splice site	probably null
R4980:Igf2r	UTSW	17	12,703,360 (GRCm38)	critical splice donor site	probably null
R5389:Igf2r	UTSW	17	12,725,416 (GRCm38)	missense	probably damaging	1.00
R5473:Igf2r	UTSW	17	12,695,314 (GRCm38)	missense	probably benign	0.20
R5494:Igf2r	UTSW	17	12,693,145 (GRCm38)	missense	possibly damaging	0.74
R5619:Igf2r	UTSW	17	12,739,334 (GRCm38)	missense	probably damaging	1.00
R5738:Igf2r	UTSW	17	12,717,367 (GRCm38)	missense	probably benign	0.23
R5761:Igf2r	UTSW	17	12,698,352 (GRCm38)	splice site	probably null
R5794:Igf2r	UTSW	17	12,709,445 (GRCm38)	missense	probably benign	0.37
R6210:Igf2r	UTSW	17	12,714,951 (GRCm38)	missense	probably damaging	0.98
R6319:Igf2r	UTSW	17	12,714,113 (GRCm38)	missense	probably damaging	1.00
R6388:Igf2r	UTSW	17	12,683,900 (GRCm38)	missense	probably benign
R6396:Igf2r	UTSW	17	12,714,090 (GRCm38)	missense	probably benign	0.00
R6584:Igf2r	UTSW	17	12,701,250 (GRCm38)	missense	probably damaging	0.99
R6590:Igf2r	UTSW	17	12,691,937 (GRCm38)	nonsense	probably null
R6591:Igf2r	UTSW	17	12,689,008 (GRCm38)	missense	probably damaging	1.00
R6599:Igf2r	UTSW	17	12,698,618 (GRCm38)	missense	possibly damaging	0.85
R6690:Igf2r	UTSW	17	12,691,937 (GRCm38)	nonsense	probably null
R6691:Igf2r	UTSW	17	12,689,008 (GRCm38)	missense	probably damaging	1.00
R6816:Igf2r	UTSW	17	12,714,082 (GRCm38)	missense	probably damaging	0.99
R6841:Igf2r	UTSW	17	12,703,376 (GRCm38)	missense	probably damaging	0.97
R6877:Igf2r	UTSW	17	12,697,341 (GRCm38)	missense	probably damaging	0.97
R6950:Igf2r	UTSW	17	12,718,718 (GRCm38)	missense	probably benign
R7030:Igf2r	UTSW	17	12,733,866 (GRCm38)	missense	probably damaging	1.00
R7038:Igf2r	UTSW	17	12,698,325 (GRCm38)	missense	probably benign	0.23
R7055:Igf2r	UTSW	17	12,704,323 (GRCm38)	missense	probably damaging	0.99
R7074:Igf2r	UTSW	17	12,714,116 (GRCm38)	missense	possibly damaging	0.57
R7348:Igf2r	UTSW	17	12,703,484 (GRCm38)	missense	probably damaging	0.99
R7413:Igf2r	UTSW	17	12,698,228 (GRCm38)	nonsense	probably null
R7463:Igf2r	UTSW	17	12,710,645 (GRCm38)	missense	probably benign	0.16
R7619:Igf2r	UTSW	17	12,698,273 (GRCm38)	missense	possibly damaging	0.88
R7730:Igf2r	UTSW	17	12,735,991 (GRCm38)	missense	probably damaging	0.98
R7733:Igf2r	UTSW	17	12,739,369 (GRCm38)	missense	possibly damaging	0.90
R7881:Igf2r	UTSW	17	12,748,704 (GRCm38)	missense	probably benign
R8022:Igf2r	UTSW	17	12,718,795 (GRCm38)	missense	probably damaging	1.00
R8138:Igf2r	UTSW	17	12,701,238 (GRCm38)	missense	probably benign	0.32
R8220:Igf2r	UTSW	17	12,692,071 (GRCm38)	missense	probably benign	0.22
R8305:Igf2r	UTSW	17	12,733,860 (GRCm38)	missense	probably benign
R8359:Igf2r	UTSW	17	12,683,861 (GRCm38)	missense	probably benign
R8500:Igf2r	UTSW	17	12,709,441 (GRCm38)	missense	probably damaging	0.99
R8510:Igf2r	UTSW	17	12,704,313 (GRCm38)	missense	probably benign	0.38
R8933:Igf2r	UTSW	17	12,704,637 (GRCm38)	missense	probably damaging	1.00
R8933:Igf2r	UTSW	17	12,701,244 (GRCm38)	missense	probably damaging	0.97
R8976:Igf2r	UTSW	17	12,726,772 (GRCm38)	missense	probably damaging	1.00
R8994:Igf2r	UTSW	17	12,716,650 (GRCm38)	missense	possibly damaging	0.87
R9059:Igf2r	UTSW	17	12,751,293 (GRCm38)	start codon destroyed	probably null
R9097:Igf2r	UTSW	17	12,691,213 (GRCm38)	missense	probably damaging	1.00
R9127:Igf2r	UTSW	17	12,739,351 (GRCm38)	missense	probably damaging	0.98
R9278:Igf2r	UTSW	17	12,695,353 (GRCm38)	missense	probably damaging	1.00
R9362:Igf2r	UTSW	17	12,722,175 (GRCm38)	missense	probably benign	0.02
R9371:Igf2r	UTSW	17	12,705,759 (GRCm38)	missense	possibly damaging	0.93
R9522:Igf2r	UTSW	17	12,698,328 (GRCm38)	missense	probably benign	0.26
R9567:Igf2r	UTSW	17	12,686,754 (GRCm38)	missense	probably damaging	1.00
R9665:Igf2r	UTSW	17	12,694,140 (GRCm38)	missense	probably benign	0.17
R9666:Igf2r	UTSW	17	12,726,701 (GRCm38)	missense	probably benign
X0028:Igf2r	UTSW	17	12,704,913 (GRCm38)	nonsense	probably null
Z1177:Igf2r	UTSW	17	12,697,399 (GRCm38)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGGATCAACCATGGCCAGTG -3'
(R):5'- CTAGTGACTAAACATGAACTGCTG -3'

Sequencing Primer
(F):5'- CCCGTCTGAACAGATTCAAGTGATG -3'
(R):5'- GAACTGCTGACTTTAGCTAGTTCAC -3'

Posted On

2018-08-01