Incidental Mutation 'R6752:H2-Q6'
ID530859
Institutional Source Beutler Lab
Gene Symbol H2-Q6
Ensembl Gene ENSMUSG00000073409
Gene Namehistocompatibility 2, Q region locus 6
Synonyms0610037M15Rik, Qa6, H-2Q6, Qa-6
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.471) question?
Stock #R6752 (G1)
Quality Score172.009
Status Not validated
Chromosome17
Chromosomal Location35424850-35430055 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35428127 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 292 (T292A)
Ref Sequence ENSEMBL: ENSMUSP00000134550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113879] [ENSMUST00000174699]
Predicted Effect probably damaging
Transcript: ENSMUST00000113879
AA Change: T292A

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109511
Gene: ENSMUSG00000073409
AA Change: T292A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 200 2.1e-92 PFAM
IGc1 219 290 7.68e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174699
AA Change: T292A

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134550
Gene: ENSMUSG00000073409
AA Change: T292A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 200 1.1e-93 PFAM
IGc1 219 290 7.68e-23 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 98% (55/56)
MGI Phenotype PHENOTYPE: This locus controls a lymph node and splenic lymphocyte antigen detected by BALB/cBy anti-ORA1-a tumor antibody. The strain distribution for presence/absence of antigen varies widely among inbred strains. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,195,483 L45S probably benign Het
Agbl2 G A 2: 90,803,074 C518Y probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Aox1 T C 1: 58,047,239 I101T probably benign Het
Arhgap23 T C 11: 97,452,248 F241S probably damaging Het
Asmt A G X: 170,676,361 M202V probably benign Het
Atp6v0a2 A G 5: 124,641,514 E189G probably damaging Het
Birc3 G A 9: 7,857,344 A376V probably benign Het
Ccbe1 C T 18: 66,076,307 probably null Het
Chst2 C A 9: 95,404,749 E515* probably null Het
Col12a1 A T 9: 79,633,424 N2426K possibly damaging Het
Dmrt2 A G 19: 25,678,342 N435S probably damaging Het
Dnah14 A G 1: 181,593,452 K123E probably benign Het
Dock4 T A 12: 40,820,617 L1452Q probably damaging Het
Galnt7 G A 8: 57,652,951 R10C probably damaging Het
Gm16506 A G 14: 43,727,419 I22T unknown Het
Ifne A G 4: 88,880,082 M33T probably benign Het
Igf2r G A 17: 12,714,944 R808W probably damaging Het
Igfbp5 T C 1: 72,863,909 E169G probably damaging Het
Inppl1 G A 7: 101,832,542 R198* probably null Het
Irgm1 T C 11: 48,866,463 T174A probably damaging Het
Itih3 C T 14: 30,923,489 G21S possibly damaging Het
Klra4 G T 6: 130,062,028 Q134K probably benign Het
Mfsd1 T A 3: 67,596,603 Y309* probably null Het
Mrps10 A G 17: 47,377,815 N162S probably damaging Het
Mtmr14 T C 6: 113,240,397 F90S probably damaging Het
Myh15 A G 16: 49,182,927 D1783G probably damaging Het
Myo3b A G 2: 70,289,512 E972G probably damaging Het
Myt1 G T 2: 181,801,082 V455F probably damaging Het
Nbea T A 3: 55,968,309 T1647S probably benign Het
Nbea A T 3: 56,037,219 S575T probably benign Het
Ntn4 A G 10: 93,734,175 N466S probably benign Het
Olfr1113 A G 2: 87,213,044 M51V probably benign Het
Olfr1468-ps1 T A 19: 13,375,526 L188H unknown Het
Olfr197 T A 16: 59,186,331 N51Y probably damaging Het
Pcdhgb4 T A 18: 37,720,651 I33N probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pom121l2 T G 13: 21,981,769 F70C probably damaging Het
Psmb5 T C 14: 54,616,755 T89A probably benign Het
Rab11fip2 T C 19: 59,907,043 D471G probably damaging Het
Rnh1 A G 7: 141,163,441 V207A probably benign Het
Sh3tc2 C A 18: 61,961,037 T49N probably benign Het
Skint4 T C 4: 112,119,863 M158T possibly damaging Het
Skint7 T A 4: 111,980,266 H80Q probably benign Het
Smg1 A G 7: 118,163,316 probably benign Het
Sostdc1 T C 12: 36,314,412 V40A probably benign Het
Sptlc1 C A 13: 53,335,358 K437N possibly damaging Het
Stat2 T C 10: 128,283,753 F503L probably damaging Het
Syt16 A T 12: 74,229,213 probably null Het
Tspyl1 T C 10: 34,282,587 S103P probably benign Het
Ube4a A T 9: 44,925,948 S1053R probably damaging Het
Vipr1 A G 9: 121,653,893 N58S probably damaging Het
Zfp184 C A 13: 21,959,408 A428E probably damaging Het
Zfp292 A C 4: 34,808,593 F1484V possibly damaging Het
Zfp599 G A 9: 22,249,544 H442Y probably damaging Het
Zfp944 G A 17: 22,339,519 T249I probably benign Het
Zkscan14 T A 5: 145,195,506 H405L probably damaging Het
Other mutations in H2-Q6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02505:H2-Q6 APN 17 35425176 missense probably benign 0.06
PIT4508001:H2-Q6 UTSW 17 35425820 missense probably damaging 1.00
R0499:H2-Q6 UTSW 17 35425203 missense probably damaging 0.98
R2426:H2-Q6 UTSW 17 35424937 missense probably benign 0.06
R3236:H2-Q6 UTSW 17 35425700 missense probably damaging 0.99
R3237:H2-Q6 UTSW 17 35425700 missense probably damaging 0.99
R3810:H2-Q6 UTSW 17 35425781 missense probably damaging 1.00
R3827:H2-Q6 UTSW 17 35425679 missense probably damaging 1.00
R3932:H2-Q6 UTSW 17 35425566 splice site probably benign
R4030:H2-Q6 UTSW 17 35425816 missense probably benign 0.00
R4529:H2-Q6 UTSW 17 35425844 missense probably null 1.00
R4558:H2-Q6 UTSW 17 35428315 missense probably benign 0.00
R5100:H2-Q6 UTSW 17 35425320 missense probably benign 0.00
R5435:H2-Q6 UTSW 17 35425685 missense probably damaging 1.00
R5455:H2-Q6 UTSW 17 35424884 missense unknown
R5724:H2-Q6 UTSW 17 35425652 missense probably damaging 1.00
R6383:H2-Q6 UTSW 17 35428383 critical splice donor site probably null
R6853:H2-Q6 UTSW 17 35428359 makesense probably null
R7421:H2-Q6 UTSW 17 35425228 missense possibly damaging 0.94
R7558:H2-Q6 UTSW 17 35425619 missense probably benign
R7762:H2-Q6 UTSW 17 35428101 missense probably benign 0.01
X0057:H2-Q6 UTSW 17 35425593 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGTCTTATGGTGCTGTCAC -3'
(R):5'- TTCGCCATGTTGGAGACAGTG -3'

Sequencing Primer
(F):5'- TGCTGACATCACCCTGACTTGG -3'
(R):5'- CCATGTTGGAGACAGTGGATGG -3'
Posted On2018-08-01