Incidental Mutation 'R6753:Tprn'
ID530870
Institutional Source Beutler Lab
Gene Symbol Tprn
Ensembl Gene ENSMUSG00000048707
Gene Nametaperin
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6753 (G1)
Quality Score103.008
Status Validated
Chromosome2
Chromosomal Location25262618-25269885 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25264038 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 451 (R451G)
Ref Sequence ENSEMBL: ENSMUSP00000109975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114336]
Predicted Effect probably benign
Transcript: ENSMUST00000114336
AA Change: R451G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109975
Gene: ENSMUSG00000048707
AA Change: R451G

DomainStartEndE-ValueType
Pfam:Phostensin_N 8 89 8.3e-38 PFAM
low complexity region 105 117 N/A INTRINSIC
internal_repeat_1 149 273 1.71e-5 PROSPERO
low complexity region 290 322 N/A INTRINSIC
low complexity region 401 410 N/A INTRINSIC
Pfam:Phostensin 506 645 1.8e-65 PFAM
low complexity region 647 665 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155738
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a sensory epithelial protein. It was defined by linkage analysis in three Pakistani families to lie between D9S1818 (centromeric) and D9SH6 (telomeric). Mutations at this locus have been associated with autosomal recessive deafness. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hearing loss and degeneration of hair cell stereocilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G A 11: 120,010,151 P1083S probably benign Het
Abcb5 T A 12: 118,944,906 N101I possibly damaging Het
Adrb2 A G 18: 62,179,553 V67A possibly damaging Het
Agk T A 6: 40,368,570 probably null Het
Akap10 A T 11: 61,886,777 M586K probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Armc1 A G 3: 19,144,398 F133L possibly damaging Het
Bank1 T C 3: 136,093,308 E424G probably damaging Het
Cacna1a A G 8: 84,580,205 E1363G probably damaging Het
Cacna1d C A 14: 30,042,786 A2076S probably damaging Het
Ccdc73 T A 2: 104,991,524 L606* probably null Het
Ccdc8 C T 7: 16,996,637 Q684* probably null Het
Ces1b T A 8: 93,067,020 K314* probably null Het
Ces1e T A 8: 93,215,128 N238I probably damaging Het
Chd4 A G 6: 125,114,300 N1238S probably benign Het
Cmtr2 T A 8: 110,222,979 D640E probably damaging Het
Col7a1 C T 9: 108,958,128 T559I unknown Het
Comt T C 16: 18,408,021 K205R probably benign Het
Dbp A T 7: 45,708,404 E232V probably damaging Het
Dcbld2 A G 16: 58,456,130 T470A possibly damaging Het
Eml6 T A 11: 29,754,987 D1519V probably damaging Het
Evpl T A 11: 116,237,906 H31L possibly damaging Het
Exoc1 T A 5: 76,563,339 I86N probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fgfr3 T C 5: 33,732,159 S301P probably benign Het
Gas2l1 C T 11: 5,064,254 V69I probably damaging Het
Gm2042 T A 12: 87,958,084 I107K probably damaging Het
Gucy1b1 T C 3: 82,039,747 D385G probably null Het
Ints1 T A 5: 139,765,175 E824D probably damaging Het
Itfg1 T C 8: 85,835,078 D142G probably benign Het
Jaml A G 9: 45,107,379 N359D probably benign Het
Kcnh7 T A 2: 62,850,377 I289L probably benign Het
Klf12 G A 14: 100,109,776 Q40* probably null Het
Mcm4 A C 16: 15,629,362 N579K possibly damaging Het
Mfsd2b A T 12: 4,867,358 F179I possibly damaging Het
Mmp11 C T 10: 75,928,374 V86M probably damaging Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Narf T A 11: 121,242,626 H84Q probably benign Het
Olfr987 C A 2: 85,331,798 M33I probably benign Het
Otog A C 7: 46,249,071 E204D probably benign Het
Parp8 G A 13: 116,895,115 H354Y possibly damaging Het
Pcnx C A 12: 81,964,480 D1238E probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pkd1l3 C T 8: 109,624,449 T642I probably damaging Het
Pkhd1l1 G A 15: 44,589,663 E3995K probably benign Het
Prdm9 A T 17: 15,544,956 Y521N probably benign Het
Prex2 A G 1: 11,184,456 S1105G probably damaging Het
Prss35 T A 9: 86,756,100 F308I probably damaging Het
Rab22a C T 2: 173,701,055 A167V probably benign Het
Rims2 A G 15: 39,566,973 Q871R possibly damaging Het
Rorb A T 19: 18,957,247 M253K probably benign Het
Ryr3 T C 2: 112,652,610 D4269G probably damaging Het
Snx11 T C 11: 96,769,906 probably benign Het
Son A G 16: 91,657,188 Q941R probably damaging Het
Sptbn2 G T 19: 4,747,785 R1880L probably benign Het
Sun1 G A 5: 139,215,259 probably null Het
Trbv30 T A 6: 41,281,377 M1K probably null Het
Ttn C A 2: 76,738,221 G25697W probably damaging Het
Ubb T G 11: 62,551,527 probably null Het
Unc13b C T 4: 43,239,331 R1038C probably damaging Het
Usp7 T C 16: 8,696,911 M687V probably benign Het
Zfp160 G A 17: 21,020,734 M21I probably benign Het
Zfp868 T C 8: 69,612,096 N196S probably benign Het
Zufsp A T 10: 33,928,029 I483N probably damaging Het
Other mutations in Tprn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03072:Tprn APN 2 25264518 missense probably damaging 1.00
IGL03139:Tprn APN 2 25264054 missense probably benign 0.31
R0568:Tprn UTSW 2 25264321 missense probably damaging 1.00
R0615:Tprn UTSW 2 25264198 missense probably damaging 0.97
R0706:Tprn UTSW 2 25264491 missense probably damaging 1.00
R1675:Tprn UTSW 2 25264409 missense probably benign 0.01
R2508:Tprn UTSW 2 25268928 missense possibly damaging 0.95
R4257:Tprn UTSW 2 25264482 missense probably damaging 1.00
R4493:Tprn UTSW 2 25268892 missense probably damaging 1.00
R4494:Tprn UTSW 2 25268892 missense probably damaging 1.00
R4898:Tprn UTSW 2 25268833 missense probably damaging 0.99
R5536:Tprn UTSW 2 25263357 missense probably benign 0.07
R5537:Tprn UTSW 2 25263357 missense probably benign 0.07
R7554:Tprn UTSW 2 25263799 missense probably damaging 1.00
X0003:Tprn UTSW 2 25268911 unclassified probably benign
X0010:Tprn UTSW 2 25268911 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTGATCCCCAAGCGCAAAG -3'
(R):5'- TTGAAAGGCCTCCTCCTCTGAG -3'

Sequencing Primer
(F):5'- AAAGCCCCTGGGAACTATCCTTTG -3'
(R):5'- AAAGGCCTCCTCCTCTGAGTCTAC -3'
Posted On2018-08-01