Incidental Mutation 'R6753:Kcnh7'
ID 530871
Institutional Source Beutler Lab
Gene Symbol Kcnh7
Ensembl Gene ENSMUSG00000059742
Gene Name potassium voltage-gated channel, subfamily H (eag-related), member 7
Synonyms erg3, 9330137I11Rik, Kv11.3
MMRRC Submission 044870-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.101) question?
Stock # R6753 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 62524428-63014980 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 62680721 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 289 (I289L)
Ref Sequence ENSEMBL: ENSMUSP00000108073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075052] [ENSMUST00000112452] [ENSMUST00000112454]
AlphaFold Q9ER47
Predicted Effect probably benign
Transcript: ENSMUST00000075052
AA Change: I289L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074563
Gene: ENSMUSG00000059742
AA Change: I289L

DomainStartEndE-ValueType
PAS 20 87 8.97e0 SMART
PAC 93 135 3.48e-1 SMART
Pfam:Ion_trans 407 674 4.9e-39 PFAM
Pfam:Ion_trans_2 588 668 3.2e-13 PFAM
cNMP 745 863 1.5e-23 SMART
low complexity region 921 940 N/A INTRINSIC
coiled coil region 1022 1058 N/A INTRINSIC
low complexity region 1114 1127 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112452
AA Change: I289L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108071
Gene: ENSMUSG00000059742
AA Change: I289L

DomainStartEndE-ValueType
PAS 20 87 8.97e0 SMART
PAC 93 135 3.48e-1 SMART
Blast:MYSc 309 426 4e-24 BLAST
low complexity region 446 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112454
AA Change: I289L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108073
Gene: ENSMUSG00000059742
AA Change: I289L

DomainStartEndE-ValueType
PAS 20 87 8.97e0 SMART
PAC 93 135 3.48e-1 SMART
Blast:MYSc 316 433 3e-24 BLAST
low complexity region 453 468 N/A INTRINSIC
Meta Mutation Damage Score 0.0599 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. There are at least two alternatively spliced transcript variants derived from this gene and encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G A 11: 119,900,977 (GRCm39) P1083S probably benign Het
Abcb5 T A 12: 118,908,641 (GRCm39) N101I possibly damaging Het
Adrb2 A G 18: 62,312,624 (GRCm39) V67A possibly damaging Het
Agk T A 6: 40,345,504 (GRCm39) probably null Het
Akap10 A T 11: 61,777,603 (GRCm39) M586K probably damaging Het
Akt3 A T 1: 176,877,756 (GRCm39) Y337* probably null Het
Armc1 A G 3: 19,198,562 (GRCm39) F133L possibly damaging Het
Bank1 T C 3: 135,799,069 (GRCm39) E424G probably damaging Het
Cacna1a A G 8: 85,306,834 (GRCm39) E1363G probably damaging Het
Cacna1d C A 14: 29,764,743 (GRCm39) A2076S probably damaging Het
Ccdc73 T A 2: 104,821,869 (GRCm39) L606* probably null Het
Ccdc8 C T 7: 16,730,562 (GRCm39) Q684* probably null Het
Ces1b T A 8: 93,793,648 (GRCm39) K314* probably null Het
Ces1e T A 8: 93,941,756 (GRCm39) N238I probably damaging Het
Chd4 A G 6: 125,091,263 (GRCm39) N1238S probably benign Het
Cmtr2 T A 8: 110,949,611 (GRCm39) D640E probably damaging Het
Col7a1 C T 9: 108,787,196 (GRCm39) T559I unknown Het
Comt T C 16: 18,226,771 (GRCm39) K205R probably benign Het
Dbp A T 7: 45,357,828 (GRCm39) E232V probably damaging Het
Dcbld2 A G 16: 58,276,493 (GRCm39) T470A possibly damaging Het
Eml6 T A 11: 29,704,987 (GRCm39) D1519V probably damaging Het
Evpl T A 11: 116,128,732 (GRCm39) H31L possibly damaging Het
Exoc1 T A 5: 76,711,186 (GRCm39) I86N probably damaging Het
Fat3 C T 9: 15,826,357 (GRCm39) E4532K possibly damaging Het
Fgfr3 T C 5: 33,889,503 (GRCm39) S301P probably benign Het
Gas2l1 C T 11: 5,014,254 (GRCm39) V69I probably damaging Het
Gm2042 T A 12: 87,924,854 (GRCm39) I107K probably damaging Het
Gucy1b1 T C 3: 81,947,054 (GRCm39) D385G probably null Het
Ints1 T A 5: 139,750,930 (GRCm39) E824D probably damaging Het
Itfg1 T C 8: 86,561,707 (GRCm39) D142G probably benign Het
Jaml A G 9: 45,018,677 (GRCm39) N359D probably benign Het
Klf12 G A 14: 100,347,212 (GRCm39) Q40* probably null Het
Mcm4 A C 16: 15,447,226 (GRCm39) N579K possibly damaging Het
Mfsd2b A T 12: 4,917,358 (GRCm39) F179I possibly damaging Het
Mmp11 C T 10: 75,764,208 (GRCm39) V86M probably damaging Het
Mogs T C 6: 83,092,863 (GRCm39) V101A probably damaging Het
Narf T A 11: 121,133,452 (GRCm39) H84Q probably benign Het
Or5ak4 C A 2: 85,162,142 (GRCm39) M33I probably benign Het
Otog A C 7: 45,898,495 (GRCm39) E204D probably benign Het
Parp8 G A 13: 117,031,651 (GRCm39) H354Y possibly damaging Het
Pcnx1 C A 12: 82,011,254 (GRCm39) D1238E probably damaging Het
Pi4ka A G 16: 17,194,846 (GRCm39) L184P possibly damaging Het
Pkd1l3 C T 8: 110,351,081 (GRCm39) T642I probably damaging Het
Pkhd1l1 G A 15: 44,453,059 (GRCm39) E3995K probably benign Het
Prdm9 A T 17: 15,765,218 (GRCm39) Y521N probably benign Het
Prex2 A G 1: 11,254,680 (GRCm39) S1105G probably damaging Het
Prss35 T A 9: 86,638,153 (GRCm39) F308I probably damaging Het
Rab22a C T 2: 173,542,848 (GRCm39) A167V probably benign Het
Rims2 A G 15: 39,430,369 (GRCm39) Q871R possibly damaging Het
Rorb A T 19: 18,934,611 (GRCm39) M253K probably benign Het
Ryr3 T C 2: 112,482,955 (GRCm39) D4269G probably damaging Het
Snx11 T C 11: 96,660,732 (GRCm39) probably benign Het
Son A G 16: 91,454,076 (GRCm39) Q941R probably damaging Het
Sptbn2 G T 19: 4,797,813 (GRCm39) R1880L probably benign Het
Sun1 G A 5: 139,201,014 (GRCm39) probably null Het
Tprn A G 2: 25,154,050 (GRCm39) R451G probably benign Het
Trbv30 T A 6: 41,258,311 (GRCm39) M1K probably null Het
Ttn C A 2: 76,568,565 (GRCm39) G25697W probably damaging Het
Ubb T G 11: 62,442,353 (GRCm39) probably null Het
Unc13b C T 4: 43,239,331 (GRCm39) R1038C probably damaging Het
Usp7 T C 16: 8,514,775 (GRCm39) M687V probably benign Het
Zfp160 G A 17: 21,240,996 (GRCm39) M21I probably benign Het
Zfp868 T C 8: 70,064,747 (GRCm39) N196S probably benign Het
Zup1 A T 10: 33,804,025 (GRCm39) I483N probably damaging Het
Other mutations in Kcnh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Kcnh7 APN 2 62,595,035 (GRCm39) missense probably benign 0.01
IGL00693:Kcnh7 APN 2 62,564,598 (GRCm39) missense probably benign 0.06
IGL00776:Kcnh7 APN 2 62,680,720 (GRCm39) missense probably benign 0.00
IGL00956:Kcnh7 APN 2 62,607,983 (GRCm39) missense probably damaging 1.00
IGL01651:Kcnh7 APN 2 62,564,628 (GRCm39) missense possibly damaging 0.47
IGL01780:Kcnh7 APN 2 62,667,507 (GRCm39) missense probably benign 0.17
IGL01859:Kcnh7 APN 2 62,552,132 (GRCm39) missense probably benign 0.00
IGL02213:Kcnh7 APN 2 62,569,706 (GRCm39) missense probably damaging 1.00
IGL02302:Kcnh7 APN 2 62,536,402 (GRCm39) missense probably damaging 1.00
IGL02526:Kcnh7 APN 2 62,680,781 (GRCm39) missense possibly damaging 0.46
IGL02850:Kcnh7 APN 2 62,618,029 (GRCm39) nonsense probably null
IGL02989:Kcnh7 APN 2 62,552,269 (GRCm39) missense probably benign
IGL02990:Kcnh7 APN 2 62,536,330 (GRCm39) missense probably benign 0.11
G1citation:Kcnh7 UTSW 2 62,618,248 (GRCm39) missense probably damaging 1.00
LCD18:Kcnh7 UTSW 2 62,880,143 (GRCm39) intron probably benign
R0129:Kcnh7 UTSW 2 62,546,503 (GRCm39) missense probably benign 0.00
R0622:Kcnh7 UTSW 2 62,667,633 (GRCm39) splice site probably null
R0638:Kcnh7 UTSW 2 62,607,854 (GRCm39) missense probably benign 0.13
R1006:Kcnh7 UTSW 2 62,546,527 (GRCm39) missense probably benign 0.00
R1200:Kcnh7 UTSW 2 62,607,739 (GRCm39) missense probably damaging 1.00
R1330:Kcnh7 UTSW 2 62,607,755 (GRCm39) missense possibly damaging 0.56
R1614:Kcnh7 UTSW 2 62,680,948 (GRCm39) missense probably benign 0.03
R1782:Kcnh7 UTSW 2 62,566,513 (GRCm39) missense probably damaging 1.00
R1861:Kcnh7 UTSW 2 62,607,736 (GRCm39) missense probably damaging 0.97
R1862:Kcnh7 UTSW 2 62,618,098 (GRCm39) missense possibly damaging 0.46
R2197:Kcnh7 UTSW 2 62,607,950 (GRCm39) missense probably damaging 1.00
R2510:Kcnh7 UTSW 2 62,552,261 (GRCm39) missense probably benign
R2988:Kcnh7 UTSW 2 62,552,172 (GRCm39) missense probably benign 0.20
R3024:Kcnh7 UTSW 2 62,595,007 (GRCm39) missense probably damaging 1.00
R3433:Kcnh7 UTSW 2 62,552,261 (GRCm39) missense probably benign
R4415:Kcnh7 UTSW 2 62,536,417 (GRCm39) missense probably damaging 1.00
R4540:Kcnh7 UTSW 2 62,569,530 (GRCm39) missense probably damaging 1.00
R4570:Kcnh7 UTSW 2 62,667,439 (GRCm39) missense possibly damaging 0.91
R4827:Kcnh7 UTSW 2 62,546,564 (GRCm39) missense probably benign
R4990:Kcnh7 UTSW 2 62,564,632 (GRCm39) missense probably benign 0.00
R5172:Kcnh7 UTSW 2 62,569,508 (GRCm39) missense possibly damaging 0.88
R5822:Kcnh7 UTSW 2 62,546,582 (GRCm39) missense probably benign
R5996:Kcnh7 UTSW 2 63,014,441 (GRCm39) start gained probably benign
R6142:Kcnh7 UTSW 2 62,569,704 (GRCm39) missense possibly damaging 0.95
R6226:Kcnh7 UTSW 2 62,607,903 (GRCm39) missense probably damaging 1.00
R6244:Kcnh7 UTSW 2 63,012,570 (GRCm39) missense probably damaging 1.00
R6304:Kcnh7 UTSW 2 62,594,960 (GRCm39) nonsense probably null
R6400:Kcnh7 UTSW 2 62,569,688 (GRCm39) missense probably damaging 1.00
R6430:Kcnh7 UTSW 2 62,680,876 (GRCm39) missense probably benign 0.04
R6483:Kcnh7 UTSW 2 62,676,118 (GRCm39) missense probably benign 0.06
R6614:Kcnh7 UTSW 2 62,607,940 (GRCm39) missense probably damaging 1.00
R6822:Kcnh7 UTSW 2 62,618,248 (GRCm39) missense probably damaging 1.00
R6863:Kcnh7 UTSW 2 62,618,029 (GRCm39) missense possibly damaging 0.83
R7104:Kcnh7 UTSW 2 62,618,031 (GRCm39) missense possibly damaging 0.82
R7116:Kcnh7 UTSW 2 62,707,614 (GRCm39) missense probably benign 0.02
R7263:Kcnh7 UTSW 2 62,566,314 (GRCm39) splice site probably null
R7657:Kcnh7 UTSW 2 62,566,379 (GRCm39) missense probably damaging 1.00
R7855:Kcnh7 UTSW 2 62,667,538 (GRCm39) nonsense probably null
R7968:Kcnh7 UTSW 2 62,566,444 (GRCm39) missense probably damaging 1.00
R8183:Kcnh7 UTSW 2 62,533,321 (GRCm39) missense probably damaging 0.99
R8343:Kcnh7 UTSW 2 62,680,879 (GRCm39) missense probably benign 0.01
R8405:Kcnh7 UTSW 2 62,533,446 (GRCm39) missense probably benign 0.04
R8411:Kcnh7 UTSW 2 62,594,952 (GRCm39) missense probably damaging 1.00
R8493:Kcnh7 UTSW 2 62,681,003 (GRCm39) missense probably benign 0.31
R8744:Kcnh7 UTSW 2 63,012,433 (GRCm39) missense possibly damaging 0.93
R8988:Kcnh7 UTSW 2 62,552,209 (GRCm39) missense
R9082:Kcnh7 UTSW 2 62,607,878 (GRCm39) missense probably damaging 1.00
R9206:Kcnh7 UTSW 2 62,607,947 (GRCm39) missense probably damaging 1.00
R9272:Kcnh7 UTSW 2 62,618,097 (GRCm39) missense probably damaging 0.99
R9382:Kcnh7 UTSW 2 62,667,612 (GRCm39) missense probably benign 0.01
R9674:Kcnh7 UTSW 2 62,595,060 (GRCm39) missense probably damaging 1.00
R9771:Kcnh7 UTSW 2 62,569,719 (GRCm39) missense probably damaging 1.00
X0011:Kcnh7 UTSW 2 62,595,067 (GRCm39) missense probably damaging 0.99
Z1088:Kcnh7 UTSW 2 63,014,412 (GRCm39) missense probably damaging 1.00
Z1088:Kcnh7 UTSW 2 62,566,447 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCACTAGGGTTCAAAGAGGAAATG -3'
(R):5'- ATACAGCCTAGCCAGTGTTCTC -3'

Sequencing Primer
(F):5'- ATGCAACGCTCGTGTTT -3'
(R):5'- CCTTAGTGAACATATCAGGACCTCTG -3'
Posted On 2018-08-01