Incidental Mutation 'R6753:Rab22a'
ID 530876
Institutional Source Beutler Lab
Gene Symbol Rab22a
Ensembl Gene ENSMUSG00000027519
Gene Name RAB22A, member RAS oncogene family
Synonyms Rab22, E130120E14Rik, 3732413A17Rik
MMRRC Submission 044870-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6753 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 173659760-173707343 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 173701055 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 167 (A167V)
Ref Sequence ENSEMBL: ENSMUSP00000104738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029024] [ENSMUST00000109110] [ENSMUST00000142820]
AlphaFold P35285
Predicted Effect probably benign
Transcript: ENSMUST00000029024
AA Change: A174V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029024
Gene: ENSMUSG00000027519
AA Change: A174V

DomainStartEndE-ValueType
RAB 6 169 1.96e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109110
AA Change: A167V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104738
Gene: ENSMUSG00000027519
AA Change: A167V

DomainStartEndE-ValueType
Pfam:Arf 1 159 2.7e-8 PFAM
Pfam:Miro 7 114 4.3e-14 PFAM
Pfam:Ras 7 161 2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142820
SMART Domains Protein: ENSMUSP00000122799
Gene: ENSMUSG00000027519

DomainStartEndE-ValueType
Pfam:Ras 7 61 1.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183857
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the RAB family of small GTPases. The GTP-bound form of the encoded protein has been shown to interact with early-endosomal antigen 1, and may be involved in the trafficking of and interaction between endosomal compartments. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G A 11: 120,010,151 (GRCm38) P1083S probably benign Het
Abcb5 T A 12: 118,944,906 (GRCm38) N101I possibly damaging Het
Adrb2 A G 18: 62,179,553 (GRCm38) V67A possibly damaging Het
Agk T A 6: 40,368,570 (GRCm38) probably null Het
Akap10 A T 11: 61,886,777 (GRCm38) M586K probably damaging Het
Akt3 A T 1: 177,050,190 (GRCm38) Y337* probably null Het
Armc1 A G 3: 19,144,398 (GRCm38) F133L possibly damaging Het
Bank1 T C 3: 136,093,308 (GRCm38) E424G probably damaging Het
Cacna1a A G 8: 84,580,205 (GRCm38) E1363G probably damaging Het
Cacna1d C A 14: 30,042,786 (GRCm38) A2076S probably damaging Het
Ccdc73 T A 2: 104,991,524 (GRCm38) L606* probably null Het
Ccdc8 C T 7: 16,996,637 (GRCm38) Q684* probably null Het
Ces1b T A 8: 93,067,020 (GRCm38) K314* probably null Het
Ces1e T A 8: 93,215,128 (GRCm38) N238I probably damaging Het
Chd4 A G 6: 125,114,300 (GRCm38) N1238S probably benign Het
Cmtr2 T A 8: 110,222,979 (GRCm38) D640E probably damaging Het
Col7a1 C T 9: 108,958,128 (GRCm38) T559I unknown Het
Comt T C 16: 18,408,021 (GRCm38) K205R probably benign Het
Dbp A T 7: 45,708,404 (GRCm38) E232V probably damaging Het
Dcbld2 A G 16: 58,456,130 (GRCm38) T470A possibly damaging Het
Eml6 T A 11: 29,754,987 (GRCm38) D1519V probably damaging Het
Evpl T A 11: 116,237,906 (GRCm38) H31L possibly damaging Het
Exoc1 T A 5: 76,563,339 (GRCm38) I86N probably damaging Het
Fat3 C T 9: 15,915,061 (GRCm38) E4532K possibly damaging Het
Fgfr3 T C 5: 33,732,159 (GRCm38) S301P probably benign Het
Gas2l1 C T 11: 5,064,254 (GRCm38) V69I probably damaging Het
Gm2042 T A 12: 87,958,084 (GRCm38) I107K probably damaging Het
Gucy1b1 T C 3: 82,039,747 (GRCm38) D385G probably null Het
Ints1 T A 5: 139,765,175 (GRCm38) E824D probably damaging Het
Itfg1 T C 8: 85,835,078 (GRCm38) D142G probably benign Het
Jaml A G 9: 45,107,379 (GRCm38) N359D probably benign Het
Kcnh7 T A 2: 62,850,377 (GRCm38) I289L probably benign Het
Klf12 G A 14: 100,109,776 (GRCm38) Q40* probably null Het
Mcm4 A C 16: 15,629,362 (GRCm38) N579K possibly damaging Het
Mfsd2b A T 12: 4,867,358 (GRCm38) F179I possibly damaging Het
Mmp11 C T 10: 75,928,374 (GRCm38) V86M probably damaging Het
Mogs T C 6: 83,115,882 (GRCm38) V101A probably damaging Het
Narf T A 11: 121,242,626 (GRCm38) H84Q probably benign Het
Or5ak4 C A 2: 85,331,798 (GRCm38) M33I probably benign Het
Otog A C 7: 46,249,071 (GRCm38) E204D probably benign Het
Parp8 G A 13: 116,895,115 (GRCm38) H354Y possibly damaging Het
Pcnx1 C A 12: 81,964,480 (GRCm38) D1238E probably damaging Het
Pi4ka A G 16: 17,376,982 (GRCm38) L184P possibly damaging Het
Pkd1l3 C T 8: 109,624,449 (GRCm38) T642I probably damaging Het
Pkhd1l1 G A 15: 44,589,663 (GRCm38) E3995K probably benign Het
Prdm9 A T 17: 15,544,956 (GRCm38) Y521N probably benign Het
Prex2 A G 1: 11,184,456 (GRCm38) S1105G probably damaging Het
Prss35 T A 9: 86,756,100 (GRCm38) F308I probably damaging Het
Rims2 A G 15: 39,566,973 (GRCm38) Q871R possibly damaging Het
Rorb A T 19: 18,957,247 (GRCm38) M253K probably benign Het
Ryr3 T C 2: 112,652,610 (GRCm38) D4269G probably damaging Het
Snx11 T C 11: 96,769,906 (GRCm38) probably benign Het
Son A G 16: 91,657,188 (GRCm38) Q941R probably damaging Het
Sptbn2 G T 19: 4,747,785 (GRCm38) R1880L probably benign Het
Sun1 G A 5: 139,215,259 (GRCm38) probably null Het
Tprn A G 2: 25,264,038 (GRCm38) R451G probably benign Het
Trbv30 T A 6: 41,281,377 (GRCm38) M1K probably null Het
Ttn C A 2: 76,738,221 (GRCm38) G25697W probably damaging Het
Ubb T G 11: 62,551,527 (GRCm38) probably null Het
Unc13b C T 4: 43,239,331 (GRCm38) R1038C probably damaging Het
Usp7 T C 16: 8,696,911 (GRCm38) M687V probably benign Het
Zfp160 G A 17: 21,020,734 (GRCm38) M21I probably benign Het
Zfp868 T C 8: 69,612,096 (GRCm38) N196S probably benign Het
Zup1 A T 10: 33,928,029 (GRCm38) I483N probably damaging Het
Other mutations in Rab22a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Rab22a APN 2 173,688,210 (GRCm38) missense probably damaging 1.00
IGL01889:Rab22a APN 2 173,688,238 (GRCm38) intron probably benign
IGL03113:Rab22a APN 2 173,661,472 (GRCm38) missense probably damaging 1.00
PIT1430001:Rab22a UTSW 2 173,695,170 (GRCm38) missense probably benign 0.09
R0304:Rab22a UTSW 2 173,661,459 (GRCm38) missense probably damaging 1.00
R1937:Rab22a UTSW 2 173,688,211 (GRCm38) missense probably damaging 1.00
R2914:Rab22a UTSW 2 173,695,281 (GRCm38) missense probably benign 0.00
R4473:Rab22a UTSW 2 173,695,263 (GRCm38) missense probably damaging 1.00
R4474:Rab22a UTSW 2 173,695,263 (GRCm38) missense probably damaging 1.00
R4476:Rab22a UTSW 2 173,695,263 (GRCm38) missense probably damaging 1.00
R4559:Rab22a UTSW 2 173,661,433 (GRCm38) missense probably damaging 1.00
R5163:Rab22a UTSW 2 173,661,487 (GRCm38) missense probably damaging 0.99
R5934:Rab22a UTSW 2 173,661,504 (GRCm38) missense probably damaging 1.00
R7654:Rab22a UTSW 2 173,688,175 (GRCm38) missense probably benign 0.00
R8089:Rab22a UTSW 2 173,688,220 (GRCm38) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGCATTAGGTGACTGTGGG -3'
(R):5'- GCTGCAGTCTTCCAAGAGAAC -3'

Sequencing Primer
(F):5'- TGGGTCAGGTGAAGAGGGATACTC -3'
(R):5'- AACAGCCGGTTCTCTGAGTC -3'
Posted On 2018-08-01