Incidental Mutation 'R6753:Armc1'
ID530877
Institutional Source Beutler Lab
Gene Symbol Armc1
Ensembl Gene ENSMUSG00000027599
Gene Namearmadillo repeat containing 1
Synonyms2310016N05Rik, C330014L16Rik, 2900046P06Rik, Arcp, 3110009G21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R6753 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location19131402-19163065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19144398 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 133 (F133L)
Ref Sequence ENSEMBL: ENSMUSP00000029125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029125]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029125
AA Change: F133L

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029125
Gene: ENSMUSG00000027599
AA Change: F133L

DomainStartEndE-ValueType
Pfam:Arm 27 68 1.1e-6 PFAM
SCOP:d1fvqa_ 142 203 6e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193065
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G A 11: 120,010,151 P1083S probably benign Het
Abcb5 T A 12: 118,944,906 N101I possibly damaging Het
Adrb2 A G 18: 62,179,553 V67A possibly damaging Het
Agk T A 6: 40,368,570 probably null Het
Akap10 A T 11: 61,886,777 M586K probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Bank1 T C 3: 136,093,308 E424G probably damaging Het
Cacna1a A G 8: 84,580,205 E1363G probably damaging Het
Cacna1d C A 14: 30,042,786 A2076S probably damaging Het
Ccdc73 T A 2: 104,991,524 L606* probably null Het
Ccdc8 C T 7: 16,996,637 Q684* probably null Het
Ces1b T A 8: 93,067,020 K314* probably null Het
Ces1e T A 8: 93,215,128 N238I probably damaging Het
Chd4 A G 6: 125,114,300 N1238S probably benign Het
Cmtr2 T A 8: 110,222,979 D640E probably damaging Het
Col7a1 C T 9: 108,958,128 T559I unknown Het
Comt T C 16: 18,408,021 K205R probably benign Het
Dbp A T 7: 45,708,404 E232V probably damaging Het
Dcbld2 A G 16: 58,456,130 T470A possibly damaging Het
Eml6 T A 11: 29,754,987 D1519V probably damaging Het
Evpl T A 11: 116,237,906 H31L possibly damaging Het
Exoc1 T A 5: 76,563,339 I86N probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fgfr3 T C 5: 33,732,159 S301P probably benign Het
Gas2l1 C T 11: 5,064,254 V69I probably damaging Het
Gm2042 T A 12: 87,958,084 I107K probably damaging Het
Gucy1b1 T C 3: 82,039,747 D385G probably null Het
Ints1 T A 5: 139,765,175 E824D probably damaging Het
Itfg1 T C 8: 85,835,078 D142G probably benign Het
Jaml A G 9: 45,107,379 N359D probably benign Het
Kcnh7 T A 2: 62,850,377 I289L probably benign Het
Klf12 G A 14: 100,109,776 Q40* probably null Het
Mcm4 A C 16: 15,629,362 N579K possibly damaging Het
Mfsd2b A T 12: 4,867,358 F179I possibly damaging Het
Mmp11 C T 10: 75,928,374 V86M probably damaging Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Narf T A 11: 121,242,626 H84Q probably benign Het
Olfr987 C A 2: 85,331,798 M33I probably benign Het
Otog A C 7: 46,249,071 E204D probably benign Het
Parp8 G A 13: 116,895,115 H354Y possibly damaging Het
Pcnx C A 12: 81,964,480 D1238E probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pkd1l3 C T 8: 109,624,449 T642I probably damaging Het
Pkhd1l1 G A 15: 44,589,663 E3995K probably benign Het
Prdm9 A T 17: 15,544,956 Y521N probably benign Het
Prex2 A G 1: 11,184,456 S1105G probably damaging Het
Prss35 T A 9: 86,756,100 F308I probably damaging Het
Rab22a C T 2: 173,701,055 A167V probably benign Het
Rims2 A G 15: 39,566,973 Q871R possibly damaging Het
Rorb A T 19: 18,957,247 M253K probably benign Het
Ryr3 T C 2: 112,652,610 D4269G probably damaging Het
Snx11 T C 11: 96,769,906 probably benign Het
Son A G 16: 91,657,188 Q941R probably damaging Het
Sptbn2 G T 19: 4,747,785 R1880L probably benign Het
Sun1 G A 5: 139,215,259 probably null Het
Tprn A G 2: 25,264,038 R451G probably benign Het
Trbv30 T A 6: 41,281,377 M1K probably null Het
Ttn C A 2: 76,738,221 G25697W probably damaging Het
Ubb T G 11: 62,551,527 probably null Het
Unc13b C T 4: 43,239,331 R1038C probably damaging Het
Usp7 T C 16: 8,696,911 M687V probably benign Het
Zfp160 G A 17: 21,020,734 M21I probably benign Het
Zfp868 T C 8: 69,612,096 N196S probably benign Het
Zufsp A T 10: 33,928,029 I483N probably damaging Het
Other mutations in Armc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Armc1 APN 3 19144420 missense probably benign 0.21
IGL01453:Armc1 APN 3 19144430 missense probably benign 0.03
IGL02012:Armc1 APN 3 19157537 missense possibly damaging 0.57
IGL02586:Armc1 APN 3 19134028 utr 3 prime probably benign
R0512:Armc1 UTSW 3 19149495 missense possibly damaging 0.87
R1694:Armc1 UTSW 3 19134886 missense possibly damaging 0.81
R1878:Armc1 UTSW 3 19157544 missense probably damaging 1.00
R1881:Armc1 UTSW 3 19134896 missense possibly damaging 0.76
R2191:Armc1 UTSW 3 19134061 missense probably damaging 1.00
R2264:Armc1 UTSW 3 19134869 missense probably damaging 1.00
R2403:Armc1 UTSW 3 19157676 start gained probably benign
R2969:Armc1 UTSW 3 19134860 missense probably benign
R3861:Armc1 UTSW 3 19135032 missense probably damaging 1.00
R4296:Armc1 UTSW 3 19149516 missense probably damaging 0.99
R6891:Armc1 UTSW 3 19135041 missense probably damaging 1.00
R7837:Armc1 UTSW 3 19144469 missense probably benign 0.01
R8373:Armc1 UTSW 3 19149567 missense probably damaging 1.00
R8743:Armc1 UTSW 3 19157536 missense probably benign 0.19
Z1088:Armc1 UTSW 3 19149507 missense probably damaging 1.00
Z1177:Armc1 UTSW 3 19149574 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TCATGCACAGCTCTAATTAGACC -3'
(R):5'- ATCAGGCTGAATGAAGCAAGACTC -3'

Sequencing Primer
(F):5'- AGCATAAGATGACCTTTTTGCC -3'
(R):5'- AAGGACTACAACTCCAGG -3'
Posted On2018-08-01