Mutagenetix > Incidental Mutation

Incidental Mutation 'R6753:Exoc1'

530882

Institutional Source

Beutler Lab

Gene Symbol

Exoc1

Ensembl Gene

ENSMUSG00000036435

Gene Name

exocyst complex component 1

Synonyms

2810407P21Rik, Sec3p, SEC3, A730011E05Rik, Sec3l1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6753 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

76529311-76570294 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 76563339 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 86 (I86N)

Ref Sequence

ENSEMBL: ENSMUSP00000121784 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049469] [ENSMUST00000087133] [ENSMUST00000113493] [ENSMUST00000134521]

AlphaFold

Q8R3S6

Predicted Effect

probably damaging
Transcript: ENSMUST00000049469
AA Change: I673N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000046719
Gene: ENSMUSG00000036435
AA Change: I673N

Domain	Start	End	E-Value	Type
Sec3-PIP2_bind	31	122	9.51e-41	SMART
Pfam:Sec3_C	169	856	5.5e-221	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000087133
AA Change: I688N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000084373
Gene: ENSMUSG00000036435
AA Change: I688N

Domain	Start	End	E-Value	Type
Sec3-PIP2_bind	31	122	9.51e-41	SMART
Pfam:Sec3_C	169	871	2e-220	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113493
AA Change: I695N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000109121
Gene: ENSMUSG00000036435
AA Change: I695N

Domain	Start	End	E-Value	Type
Sec3-PIP2_bind	31	122	9.51e-41	SMART
coiled coil region	161	183	N/A	INTRINSIC
Pfam:Sec3_C	190	878	4.1e-186	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131470

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132807

Predicted Effect

probably damaging
Transcript: ENSMUST00000134521
AA Change: I86N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000121784
Gene: ENSMUSG00000036435
AA Change: I86N

Domain	Start	End	E-Value	Type
Pfam:Sec3_C	1	111	1.7e-35	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143489

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143736

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.1%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality before implantation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	G	A	11: 120,010,151	P1083S	probably benign	Het
Abcb5	T	A	12: 118,944,906	N101I	possibly damaging	Het
Adrb2	A	G	18: 62,179,553	V67A	possibly damaging	Het
Agk	T	A	6: 40,368,570		probably null	Het
Akap10	A	T	11: 61,886,777	M586K	probably damaging	Het
Akt3	A	T	1: 177,050,190	Y337*	probably null	Het
Armc1	A	G	3: 19,144,398	F133L	possibly damaging	Het
Bank1	T	C	3: 136,093,308	E424G	probably damaging	Het
Cacna1a	A	G	8: 84,580,205	E1363G	probably damaging	Het
Cacna1d	C	A	14: 30,042,786	A2076S	probably damaging	Het
Ccdc73	T	A	2: 104,991,524	L606*	probably null	Het
Ccdc8	C	T	7: 16,996,637	Q684*	probably null	Het
Ces1b	T	A	8: 93,067,020	K314*	probably null	Het
Ces1e	T	A	8: 93,215,128	N238I	probably damaging	Het
Chd4	A	G	6: 125,114,300	N1238S	probably benign	Het
Cmtr2	T	A	8: 110,222,979	D640E	probably damaging	Het
Col7a1	C	T	9: 108,958,128	T559I	unknown	Het
Comt	T	C	16: 18,408,021	K205R	probably benign	Het
Dbp	A	T	7: 45,708,404	E232V	probably damaging	Het
Dcbld2	A	G	16: 58,456,130	T470A	possibly damaging	Het
Eml6	T	A	11: 29,754,987	D1519V	probably damaging	Het
Evpl	T	A	11: 116,237,906	H31L	possibly damaging	Het
Fat3	C	T	9: 15,915,061	E4532K	possibly damaging	Het
Fgfr3	T	C	5: 33,732,159	S301P	probably benign	Het
Gas2l1	C	T	11: 5,064,254	V69I	probably damaging	Het
Gm2042	T	A	12: 87,958,084	I107K	probably damaging	Het
Gucy1b1	T	C	3: 82,039,747	D385G	probably null	Het
Ints1	T	A	5: 139,765,175	E824D	probably damaging	Het
Itfg1	T	C	8: 85,835,078	D142G	probably benign	Het
Jaml	A	G	9: 45,107,379	N359D	probably benign	Het
Kcnh7	T	A	2: 62,850,377	I289L	probably benign	Het
Klf12	G	A	14: 100,109,776	Q40*	probably null	Het
Mcm4	A	C	16: 15,629,362	N579K	possibly damaging	Het
Mfsd2b	A	T	12: 4,867,358	F179I	possibly damaging	Het
Mmp11	C	T	10: 75,928,374	V86M	probably damaging	Het
Mogs	T	C	6: 83,115,882	V101A	probably damaging	Het
Narf	T	A	11: 121,242,626	H84Q	probably benign	Het
Olfr987	C	A	2: 85,331,798	M33I	probably benign	Het
Otog	A	C	7: 46,249,071	E204D	probably benign	Het
Parp8	G	A	13: 116,895,115	H354Y	possibly damaging	Het
Pcnx	C	A	12: 81,964,480	D1238E	probably damaging	Het
Pi4ka	A	G	16: 17,376,982	L184P	possibly damaging	Het
Pkd1l3	C	T	8: 109,624,449	T642I	probably damaging	Het
Pkhd1l1	G	A	15: 44,589,663	E3995K	probably benign	Het
Prdm9	A	T	17: 15,544,956	Y521N	probably benign	Het
Prex2	A	G	1: 11,184,456	S1105G	probably damaging	Het
Prss35	T	A	9: 86,756,100	F308I	probably damaging	Het
Rab22a	C	T	2: 173,701,055	A167V	probably benign	Het
Rims2	A	G	15: 39,566,973	Q871R	possibly damaging	Het
Rorb	A	T	19: 18,957,247	M253K	probably benign	Het
Ryr3	T	C	2: 112,652,610	D4269G	probably damaging	Het
Snx11	T	C	11: 96,769,906		probably benign	Het
Son	A	G	16: 91,657,188	Q941R	probably damaging	Het
Sptbn2	G	T	19: 4,747,785	R1880L	probably benign	Het
Sun1	G	A	5: 139,215,259		probably null	Het
Tprn	A	G	2: 25,264,038	R451G	probably benign	Het
Trbv30	T	A	6: 41,281,377	M1K	probably null	Het
Ttn	C	A	2: 76,738,221	G25697W	probably damaging	Het
Ubb	T	G	11: 62,551,527		probably null	Het
Unc13b	C	T	4: 43,239,331	R1038C	probably damaging	Het
Usp7	T	C	16: 8,696,911	M687V	probably benign	Het
Zfp160	G	A	17: 21,020,734	M21I	probably benign	Het
Zfp868	T	C	8: 69,612,096	N196S	probably benign	Het
Zufsp	A	T	10: 33,928,029	I483N	probably damaging	Het

Other mutations in Exoc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00679:Exoc1	APN	5	76567023	missense	possibly damaging	0.88
IGL01149:Exoc1	APN	5	76542244	splice site	probably benign
IGL02061:Exoc1	APN	5	76542120	missense	probably damaging	0.96
IGL02288:Exoc1	APN	5	76545313	missense	probably benign
IGL02407:Exoc1	APN	5	76545346	missense	probably damaging	0.97
IGL03089:Exoc1	APN	5	76542158	missense	possibly damaging	0.81
IGL03242:Exoc1	APN	5	76559007	missense	probably damaging	1.00
IGL03348:Exoc1	APN	5	76535593	missense	probably damaging	1.00
IGL03411:Exoc1	APN	5	76542195	missense	probably damaging	1.00
Smalls	UTSW	5	76537779	missense	probably damaging	1.00
R0462:Exoc1	UTSW	5	76543617	missense	probably benign	0.37
R1216:Exoc1	UTSW	5	76554188	missense	probably benign
R1528:Exoc1	UTSW	5	76549564	missense	possibly damaging	0.94
R1531:Exoc1	UTSW	5	76559164	missense	probably damaging	0.98
R1636:Exoc1	UTSW	5	76568118	missense	probably benign	0.03
R1754:Exoc1	UTSW	5	76560322	splice site	probably null
R1803:Exoc1	UTSW	5	76561441	missense	probably benign	0.18
R2086:Exoc1	UTSW	5	76532846	nonsense	probably null
R2239:Exoc1	UTSW	5	76559710	unclassified	probably benign
R3914:Exoc1	UTSW	5	76543561	missense	possibly damaging	0.54
R4022:Exoc1	UTSW	5	76549570	missense	possibly damaging	0.92
R4329:Exoc1	UTSW	5	76567975	missense	probably damaging	1.00
R4413:Exoc1	UTSW	5	76542019	intron	probably benign
R4427:Exoc1	UTSW	5	76563263	missense	probably benign	0.00
R4557:Exoc1	UTSW	5	76561443	missense	probably damaging	1.00
R4627:Exoc1	UTSW	5	76542228	missense	probably benign	0.26
R4677:Exoc1	UTSW	5	76559163	missense	probably null	0.82
R5138:Exoc1	UTSW	5	76568075	missense	probably damaging	1.00
R5325:Exoc1	UTSW	5	76537702	missense	probably benign
R5342:Exoc1	UTSW	5	76567014	missense	probably damaging	1.00
R5736:Exoc1	UTSW	5	76537768	missense	possibly damaging	0.90
R5891:Exoc1	UTSW	5	76542144	missense	probably damaging	1.00
R6102:Exoc1	UTSW	5	76537779	missense	probably damaging	1.00
R6447:Exoc1	UTSW	5	76543517	missense	probably damaging	0.97
R6532:Exoc1	UTSW	5	76537837	missense	probably damaging	0.99
R6694:Exoc1	UTSW	5	76549552	missense	probably damaging	1.00
R6885:Exoc1	UTSW	5	76559042	missense	probably damaging	1.00
R7090:Exoc1	UTSW	5	76566953	missense	unknown
R7299:Exoc1	UTSW	5	76542159	missense	probably damaging	1.00
R7439:Exoc1	UTSW	5	76545348	missense	probably benign	0.18
R7567:Exoc1	UTSW	5	76537715	missense	probably damaging	0.96
R7665:Exoc1	UTSW	5	76543573	missense	probably benign	0.33
R7745:Exoc1	UTSW	5	76561512	nonsense	probably null
R7883:Exoc1	UTSW	5	76561382	missense	probably damaging	0.99
R7918:Exoc1	UTSW	5	76543993	missense	probably benign	0.10
R7956:Exoc1	UTSW	5	76557857	missense	probably benign	0.01
R7977:Exoc1	UTSW	5	76543585	missense	probably damaging	1.00
R7987:Exoc1	UTSW	5	76543585	missense	probably damaging	1.00
R8191:Exoc1	UTSW	5	76559827	critical splice donor site	probably null
R8286:Exoc1	UTSW	5	76563240	missense	probably benign	0.00
R8670:Exoc1	UTSW	5	76569658	missense	probably damaging	1.00
R8791:Exoc1	UTSW	5	76535565	missense	probably damaging	1.00
R9308:Exoc1	UTSW	5	76559121	missense	probably benign	0.10
R9410:Exoc1	UTSW	5	76559142	missense	probably benign	0.21
R9717:Exoc1	UTSW	5	76563232	missense	probably benign	0.22
X0018:Exoc1	UTSW	5	76567035	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGCAGAGGACTGGTTCTCTC -3'
(R):5'- ACTACAGACTACTGAAAACAGTGAG -3'

Sequencing Primer
(F):5'- TCTTCAGGCGAGCTCTGACAG -3'
(R):5'- AGTGAGCATGGCTACACCCAG -3'

Posted On

2018-08-01