Incidental Mutation 'R6753:Ints1'
ID530884
Institutional Source Beutler Lab
Gene Symbol Ints1
Ensembl Gene ENSMUSG00000029547
Gene Nameintegrator complex subunit 1
Synonyms1110015K06Rik
MMRRC Submission
Accession Numbers

Genbank: NM_026748; MGI: 1915760

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6753 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location139751282-139775674 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 139765175 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 824 (E824D)
Ref Sequence ENSEMBL: ENSMUSP00000143789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072607] [ENSMUST00000200393]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072607
AA Change: E822D

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072406
Gene: ENSMUSG00000029547
AA Change: E822D

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 88 102 N/A INTRINSIC
Pfam:DUF3677 379 459 6.4e-37 PFAM
low complexity region 854 865 N/A INTRINSIC
low complexity region 870 876 N/A INTRINSIC
low complexity region 946 962 N/A INTRINSIC
low complexity region 965 988 N/A INTRINSIC
low complexity region 1034 1045 N/A INTRINSIC
low complexity region 1058 1069 N/A INTRINSIC
low complexity region 1347 1361 N/A INTRINSIC
low complexity region 1405 1418 N/A INTRINSIC
low complexity region 1615 1624 N/A INTRINSIC
low complexity region 1763 1776 N/A INTRINSIC
low complexity region 1840 1855 N/A INTRINSIC
low complexity region 2062 2076 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184414
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200339
Predicted Effect probably damaging
Transcript: ENSMUST00000200393
AA Change: E824D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143789
Gene: ENSMUSG00000029547
AA Change: E824D

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 88 102 N/A INTRINSIC
Pfam:DUF3677 379 459 6.4e-37 PFAM
low complexity region 854 865 N/A INTRINSIC
low complexity region 870 876 N/A INTRINSIC
low complexity region 946 962 N/A INTRINSIC
low complexity region 965 988 N/A INTRINSIC
low complexity region 1034 1045 N/A INTRINSIC
low complexity region 1058 1069 N/A INTRINSIC
low complexity region 1347 1361 N/A INTRINSIC
low complexity region 1405 1418 N/A INTRINSIC
low complexity region 1615 1624 N/A INTRINSIC
low complexity region 1763 1776 N/A INTRINSIC
low complexity region 1840 1855 N/A INTRINSIC
low complexity region 2062 2076 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS1 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality at the blastocyst stage. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Gene trapped(9)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G A 11: 120,010,151 P1083S probably benign Het
Abcb5 T A 12: 118,944,906 N101I possibly damaging Het
Adrb2 A G 18: 62,179,553 V67A possibly damaging Het
Agk T A 6: 40,368,570 probably null Het
Akap10 A T 11: 61,886,777 M586K probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Armc1 A G 3: 19,144,398 F133L possibly damaging Het
Bank1 T C 3: 136,093,308 E424G probably damaging Het
Cacna1a A G 8: 84,580,205 E1363G probably damaging Het
Cacna1d C A 14: 30,042,786 A2076S probably damaging Het
Ccdc73 T A 2: 104,991,524 L606* probably null Het
Ccdc8 C T 7: 16,996,637 Q684* probably null Het
Ces1b T A 8: 93,067,020 K314* probably null Het
Ces1e T A 8: 93,215,128 N238I probably damaging Het
Chd4 A G 6: 125,114,300 N1238S probably benign Het
Cmtr2 T A 8: 110,222,979 D640E probably damaging Het
Col7a1 C T 9: 108,958,128 T559I unknown Het
Comt T C 16: 18,408,021 K205R probably benign Het
Dbp A T 7: 45,708,404 E232V probably damaging Het
Dcbld2 A G 16: 58,456,130 T470A possibly damaging Het
Eml6 T A 11: 29,754,987 D1519V probably damaging Het
Evpl T A 11: 116,237,906 H31L possibly damaging Het
Exoc1 T A 5: 76,563,339 I86N probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fgfr3 T C 5: 33,732,159 S301P probably benign Het
Gas2l1 C T 11: 5,064,254 V69I probably damaging Het
Gm2042 T A 12: 87,958,084 I107K probably damaging Het
Gucy1b1 T C 3: 82,039,747 D385G probably null Het
Itfg1 T C 8: 85,835,078 D142G probably benign Het
Jaml A G 9: 45,107,379 N359D probably benign Het
Kcnh7 T A 2: 62,850,377 I289L probably benign Het
Klf12 G A 14: 100,109,776 Q40* probably null Het
Mcm4 A C 16: 15,629,362 N579K possibly damaging Het
Mfsd2b A T 12: 4,867,358 F179I possibly damaging Het
Mmp11 C T 10: 75,928,374 V86M probably damaging Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Narf T A 11: 121,242,626 H84Q probably benign Het
Olfr987 C A 2: 85,331,798 M33I probably benign Het
Otog A C 7: 46,249,071 E204D probably benign Het
Parp8 G A 13: 116,895,115 H354Y possibly damaging Het
Pcnx C A 12: 81,964,480 D1238E probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pkd1l3 C T 8: 109,624,449 T642I probably damaging Het
Pkhd1l1 G A 15: 44,589,663 E3995K probably benign Het
Prdm9 A T 17: 15,544,956 Y521N probably benign Het
Prex2 A G 1: 11,184,456 S1105G probably damaging Het
Prss35 T A 9: 86,756,100 F308I probably damaging Het
Rab22a C T 2: 173,701,055 A167V probably benign Het
Rims2 A G 15: 39,566,973 Q871R possibly damaging Het
Rorb A T 19: 18,957,247 M253K probably benign Het
Ryr3 T C 2: 112,652,610 D4269G probably damaging Het
Snx11 T C 11: 96,769,906 probably benign Het
Son A G 16: 91,657,188 Q941R probably damaging Het
Sptbn2 G T 19: 4,747,785 R1880L probably benign Het
Sun1 G A 5: 139,215,259 probably null Het
Tprn A G 2: 25,264,038 R451G probably benign Het
Trbv30 T A 6: 41,281,377 M1K probably null Het
Ttn C A 2: 76,738,221 G25697W probably damaging Het
Ubb T G 11: 62,551,527 probably null Het
Unc13b C T 4: 43,239,331 R1038C probably damaging Het
Usp7 T C 16: 8,696,911 M687V probably benign Het
Zfp160 G A 17: 21,020,734 M21I probably benign Het
Zfp868 T C 8: 69,612,096 N196S probably benign Het
Zufsp A T 10: 33,928,029 I483N probably damaging Het
Other mutations in Ints1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Ints1 APN 5 139771682 missense probably damaging 0.99
IGL01329:Ints1 APN 5 139767503 splice site probably benign
IGL01414:Ints1 APN 5 139758498 missense probably benign
IGL01612:Ints1 APN 5 139756292 missense probably benign 0.17
IGL01726:Ints1 APN 5 139768411 splice site probably benign
IGL01958:Ints1 APN 5 139760088 missense possibly damaging 0.94
IGL02122:Ints1 APN 5 139765150 nonsense probably null
IGL02149:Ints1 APN 5 139751960 missense probably damaging 1.00
IGL02349:Ints1 APN 5 139768468 missense probably damaging 0.96
IGL02557:Ints1 APN 5 139771637 missense probably damaging 1.00
IGL02814:Ints1 APN 5 139772391 missense possibly damaging 0.80
IGL02815:Ints1 APN 5 139755282 missense probably damaging 0.96
IGL02825:Ints1 APN 5 139764739 missense probably benign 0.32
IGL03000:Ints1 APN 5 139766506 missense probably benign 0.01
IGL03164:Ints1 APN 5 139752735 missense probably damaging 0.99
forgiving UTSW 5 139767828 missense probably damaging 0.99
restrained UTSW 5 139767726 missense possibly damaging 0.68
A9681:Ints1 UTSW 5 139770139 missense possibly damaging 0.56
R0113:Ints1 UTSW 5 139765213 missense
R0193:Ints1 UTSW 5 139751730 missense probably damaging 1.00
R0372:Ints1 UTSW 5 139772438 missense probably damaging 1.00
R1129:Ints1 UTSW 5 139758471 missense probably benign 0.00
R1290:Ints1 UTSW 5 139771410 nonsense probably null
R1313:Ints1 UTSW 5 139762906 missense probably benign
R1313:Ints1 UTSW 5 139762906 missense probably benign
R1691:Ints1 UTSW 5 139768932 missense probably damaging 1.00
R1708:Ints1 UTSW 5 139762839 missense probably damaging 1.00
R1791:Ints1 UTSW 5 139774522 missense probably benign 0.04
R2066:Ints1 UTSW 5 139767496 missense probably benign 0.14
R2102:Ints1 UTSW 5 139755999 missense possibly damaging 0.50
R2108:Ints1 UTSW 5 139767750 missense probably damaging 1.00
R2238:Ints1 UTSW 5 139765200 missense possibly damaging 0.95
R2426:Ints1 UTSW 5 139771814 critical splice donor site probably null
R2913:Ints1 UTSW 5 139757913 missense possibly damaging 0.91
R3896:Ints1 UTSW 5 139757644 nonsense probably null
R4608:Ints1 UTSW 5 139759844 missense probably benign 0.13
R4658:Ints1 UTSW 5 139774299 missense possibly damaging 0.88
R4797:Ints1 UTSW 5 139771876 missense possibly damaging 0.85
R4887:Ints1 UTSW 5 139771156 missense possibly damaging 0.66
R4944:Ints1 UTSW 5 139758092 splice site probably null
R4956:Ints1 UTSW 5 139757130 missense probably damaging 1.00
R4976:Ints1 UTSW 5 139752811 missense probably damaging 1.00
R5283:Ints1 UTSW 5 139764382 missense probably damaging 1.00
R5354:Ints1 UTSW 5 139766428 critical splice donor site probably null
R5496:Ints1 UTSW 5 139755198 missense probably benign 0.07
R5517:Ints1 UTSW 5 139752787 missense possibly damaging 0.86
R5696:Ints1 UTSW 5 139754989 missense probably benign 0.00
R5766:Ints1 UTSW 5 139772145 missense probably benign 0.33
R6359:Ints1 UTSW 5 139756217 missense probably benign 0.09
R6892:Ints1 UTSW 5 139767828 missense probably damaging 0.99
R7009:Ints1 UTSW 5 139768462 missense possibly damaging 0.83
R7047:Ints1 UTSW 5 139758471 nonsense probably null
R7216:Ints1 UTSW 5 139768984 missense possibly damaging 0.91
R7220:Ints1 UTSW 5 139762073 missense possibly damaging 0.91
R7263:Ints1 UTSW 5 139764079 missense possibly damaging 0.50
R7291:Ints1 UTSW 5 139765074 missense probably damaging 1.00
R7319:Ints1 UTSW 5 139760765 missense probably damaging 1.00
R7411:Ints1 UTSW 5 139764260 missense possibly damaging 0.54
R7497:Ints1 UTSW 5 139768976 missense probably damaging 0.99
R7529:Ints1 UTSW 5 139767726 missense possibly damaging 0.68
R7710:Ints1 UTSW 5 139771085 missense probably benign 0.17
R7816:Ints1 UTSW 5 139771379 missense possibly damaging 0.90
R7819:Ints1 UTSW 5 139760767 missense probably damaging 1.00
R7992:Ints1 UTSW 5 139756527 missense probably damaging 1.00
R8260:Ints1 UTSW 5 139765213 missense
R8265:Ints1 UTSW 5 139772164 missense probably damaging 1.00
R8782:Ints1 UTSW 5 139759197 missense probably benign 0.28
Z1177:Ints1 UTSW 5 139771638 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- AGGTTAGCTCTGCCTGTTCC -3'
(R):5'- ACTGGGGCTTAACTGGGTAG -3'

Sequencing Primer
(F):5'- GTTAGCTCTGCCTGTTCCTCATC -3'
(R):5'- TGGCTCAGTGGTCAGGC -3'
Posted On2018-08-01