Mutagenetix > Incidental Mutation

Incidental Mutation 'R6753:Chd4'

530889

Institutional Source

Beutler Lab

Gene Symbol

Chd4

Ensembl Gene

ENSMUSG00000063870

Gene Name

chromodomain helicase DNA binding protein 4

Synonyms

D6Ertd380e, Mi-2beta, 9530019N15Rik

MMRRC Submission

044870-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6753 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

125095981-125130591 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 125114300 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1238 (N1238S)

Ref Sequence

ENSEMBL: ENSMUSP00000108009 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056889] [ENSMUST00000112390] [ENSMUST00000112392] [ENSMUST00000124317]

AlphaFold

Q6PDQ2

Predicted Effect

probably benign
Transcript: ENSMUST00000056889
AA Change: N1231S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000060054
Gene: ENSMUSG00000063870
AA Change: N1231S

Domain	Start	End	E-Value	Type
low complexity region	29	45	N/A	INTRINSIC
low complexity region	49	69	N/A	INTRINSIC
low complexity region	80	92	N/A	INTRINSIC
low complexity region	107	144	N/A	INTRINSIC
Pfam:CHDNT	156	210	7.7e-35	PFAM
low complexity region	217	249	N/A	INTRINSIC
low complexity region	271	291	N/A	INTRINSIC
low complexity region	296	318	N/A	INTRINSIC
low complexity region	321	347	N/A	INTRINSIC
PHD	365	408	7.17e-15	SMART
RING	366	407	7.46e-1	SMART
low complexity region	424	443	N/A	INTRINSIC
PHD	444	487	4.41e-15	SMART
RING	445	486	2.63e0	SMART
CHROMO	492	572	8.11e-17	SMART
CHROMO	613	670	1.98e-11	SMART
low complexity region	675	694	N/A	INTRINSIC
DEXDc	715	927	2.73e-37	SMART
low complexity region	1044	1056	N/A	INTRINSIC
HELICc	1073	1157	7.61e-27	SMART
DUF1087	1282	1346	5.56e-33	SMART
DUF1086	1359	1516	4.05e-108	SMART
low complexity region	1526	1540	N/A	INTRINSIC
low complexity region	1560	1578	N/A	INTRINSIC
low complexity region	1590	1633	N/A	INTRINSIC
low complexity region	1635	1653	N/A	INTRINSIC
low complexity region	1661	1674	N/A	INTRINSIC
Pfam:CHDCT2	1727	1899	1.9e-98	PFAM
low complexity region	1903	1915	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112390
AA Change: N1238S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000108009
Gene: ENSMUSG00000063870
AA Change: N1238S

Domain	Start	End	E-Value	Type
low complexity region	29	45	N/A	INTRINSIC
low complexity region	49	69	N/A	INTRINSIC
low complexity region	87	99	N/A	INTRINSIC
low complexity region	114	151	N/A	INTRINSIC
Pfam:CHDNT	164	217	2e-28	PFAM
low complexity region	224	256	N/A	INTRINSIC
low complexity region	278	298	N/A	INTRINSIC
low complexity region	303	325	N/A	INTRINSIC
low complexity region	328	354	N/A	INTRINSIC
PHD	372	415	7.17e-15	SMART
RING	373	414	7.46e-1	SMART
low complexity region	431	450	N/A	INTRINSIC
PHD	451	494	4.41e-15	SMART
RING	452	493	2.63e0	SMART
CHROMO	499	579	8.11e-17	SMART
CHROMO	620	677	1.98e-11	SMART
low complexity region	682	701	N/A	INTRINSIC
DEXDc	722	934	2.73e-37	SMART
low complexity region	1051	1063	N/A	INTRINSIC
HELICc	1080	1164	7.61e-27	SMART
DUF1087	1289	1353	5.56e-33	SMART
DUF1086	1366	1523	4.05e-108	SMART
low complexity region	1533	1547	N/A	INTRINSIC
low complexity region	1567	1585	N/A	INTRINSIC
low complexity region	1597	1640	N/A	INTRINSIC
low complexity region	1642	1660	N/A	INTRINSIC
low complexity region	1668	1681	N/A	INTRINSIC
Pfam:CHDCT2	1735	1906	4.3e-90	PFAM
low complexity region	1910	1922	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112392
AA Change: N1218S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000108011
Gene: ENSMUSG00000063870
AA Change: N1218S

Domain	Start	End	E-Value	Type
low complexity region	29	45	N/A	INTRINSIC
low complexity region	49	69	N/A	INTRINSIC
low complexity region	80	92	N/A	INTRINSIC
low complexity region	107	144	N/A	INTRINSIC
Pfam:CHDNT	156	210	1.1e-34	PFAM
low complexity region	217	249	N/A	INTRINSIC
low complexity region	271	291	N/A	INTRINSIC
low complexity region	296	318	N/A	INTRINSIC
low complexity region	321	347	N/A	INTRINSIC
PHD	352	395	7.17e-15	SMART
RING	353	394	7.46e-1	SMART
low complexity region	411	430	N/A	INTRINSIC
PHD	431	474	4.41e-15	SMART
RING	432	473	2.63e0	SMART
CHROMO	479	559	8.11e-17	SMART
CHROMO	600	657	1.98e-11	SMART
low complexity region	662	681	N/A	INTRINSIC
DEXDc	702	914	2.73e-37	SMART
low complexity region	1031	1043	N/A	INTRINSIC
HELICc	1060	1144	7.61e-27	SMART
DUF1087	1269	1333	5.56e-33	SMART
DUF1086	1346	1503	4.05e-108	SMART
low complexity region	1513	1527	N/A	INTRINSIC
low complexity region	1547	1565	N/A	INTRINSIC
low complexity region	1577	1620	N/A	INTRINSIC
low complexity region	1622	1640	N/A	INTRINSIC
low complexity region	1648	1661	N/A	INTRINSIC
Pfam:CHDCT2	1714	1886	2.8e-98	PFAM
low complexity region	1890	1902	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124317
AA Change: N90S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000120704
Gene: ENSMUSG00000063870
AA Change: N90S

Domain	Start	End	E-Value	Type
PDB:3MWY\|W	1	137	2e-13	PDB
DUF1087	141	205	5.56e-33	SMART
low complexity region	209	221	N/A	INTRINSIC
DUF1086	246	403	4.05e-108	SMART
low complexity region	413	427	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138968

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.1%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the SNF2/RAD54 helicase family. It represents the main component of the nucleosome remodeling and deacetylase complex and plays an important role in epigenetic transcriptional repression. Patients with dermatomyositis develop antibodies against this protein. Somatic mutations in this gene are associated with serous endometrial tumors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality between E3.5 and E4.5, absent blastocoele failure of trophectoderm function and increased apoptosis in blastocysts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	G	A	11: 120,010,151	P1083S	probably benign	Het
Abcb5	T	A	12: 118,944,906	N101I	possibly damaging	Het
Adrb2	A	G	18: 62,179,553	V67A	possibly damaging	Het
Agk	T	A	6: 40,368,570		probably null	Het
Akap10	A	T	11: 61,886,777	M586K	probably damaging	Het
Akt3	A	T	1: 177,050,190	Y337*	probably null	Het
Armc1	A	G	3: 19,144,398	F133L	possibly damaging	Het
Bank1	T	C	3: 136,093,308	E424G	probably damaging	Het
Cacna1a	A	G	8: 84,580,205	E1363G	probably damaging	Het
Cacna1d	C	A	14: 30,042,786	A2076S	probably damaging	Het
Ccdc73	T	A	2: 104,991,524	L606*	probably null	Het
Ccdc8	C	T	7: 16,996,637	Q684*	probably null	Het
Ces1b	T	A	8: 93,067,020	K314*	probably null	Het
Ces1e	T	A	8: 93,215,128	N238I	probably damaging	Het
Cmtr2	T	A	8: 110,222,979	D640E	probably damaging	Het
Col7a1	C	T	9: 108,958,128	T559I	unknown	Het
Comt	T	C	16: 18,408,021	K205R	probably benign	Het
Dbp	A	T	7: 45,708,404	E232V	probably damaging	Het
Dcbld2	A	G	16: 58,456,130	T470A	possibly damaging	Het
Eml6	T	A	11: 29,754,987	D1519V	probably damaging	Het
Evpl	T	A	11: 116,237,906	H31L	possibly damaging	Het
Exoc1	T	A	5: 76,563,339	I86N	probably damaging	Het
Fat3	C	T	9: 15,915,061	E4532K	possibly damaging	Het
Fgfr3	T	C	5: 33,732,159	S301P	probably benign	Het
Gas2l1	C	T	11: 5,064,254	V69I	probably damaging	Het
Gm2042	T	A	12: 87,958,084	I107K	probably damaging	Het
Gucy1b1	T	C	3: 82,039,747	D385G	probably null	Het
Ints1	T	A	5: 139,765,175	E824D	probably damaging	Het
Itfg1	T	C	8: 85,835,078	D142G	probably benign	Het
Jaml	A	G	9: 45,107,379	N359D	probably benign	Het
Kcnh7	T	A	2: 62,850,377	I289L	probably benign	Het
Klf12	G	A	14: 100,109,776	Q40*	probably null	Het
Mcm4	A	C	16: 15,629,362	N579K	possibly damaging	Het
Mfsd2b	A	T	12: 4,867,358	F179I	possibly damaging	Het
Mmp11	C	T	10: 75,928,374	V86M	probably damaging	Het
Mogs	T	C	6: 83,115,882	V101A	probably damaging	Het
Narf	T	A	11: 121,242,626	H84Q	probably benign	Het
Olfr987	C	A	2: 85,331,798	M33I	probably benign	Het
Otog	A	C	7: 46,249,071	E204D	probably benign	Het
Parp8	G	A	13: 116,895,115	H354Y	possibly damaging	Het
Pcnx	C	A	12: 81,964,480	D1238E	probably damaging	Het
Pi4ka	A	G	16: 17,376,982	L184P	possibly damaging	Het
Pkd1l3	C	T	8: 109,624,449	T642I	probably damaging	Het
Pkhd1l1	G	A	15: 44,589,663	E3995K	probably benign	Het
Prdm9	A	T	17: 15,544,956	Y521N	probably benign	Het
Prex2	A	G	1: 11,184,456	S1105G	probably damaging	Het
Prss35	T	A	9: 86,756,100	F308I	probably damaging	Het
Rab22a	C	T	2: 173,701,055	A167V	probably benign	Het
Rims2	A	G	15: 39,566,973	Q871R	possibly damaging	Het
Rorb	A	T	19: 18,957,247	M253K	probably benign	Het
Ryr3	T	C	2: 112,652,610	D4269G	probably damaging	Het
Snx11	T	C	11: 96,769,906		probably benign	Het
Son	A	G	16: 91,657,188	Q941R	probably damaging	Het
Sptbn2	G	T	19: 4,747,785	R1880L	probably benign	Het
Sun1	G	A	5: 139,215,259		probably null	Het
Tprn	A	G	2: 25,264,038	R451G	probably benign	Het
Trbv30	T	A	6: 41,281,377	M1K	probably null	Het
Ttn	C	A	2: 76,738,221	G25697W	probably damaging	Het
Ubb	T	G	11: 62,551,527		probably null	Het
Unc13b	C	T	4: 43,239,331	R1038C	probably damaging	Het
Usp7	T	C	16: 8,696,911	M687V	probably benign	Het
Zfp160	G	A	17: 21,020,734	M21I	probably benign	Het
Zfp868	T	C	8: 69,612,096	N196S	probably benign	Het
Zufsp	A	T	10: 33,928,029	I483N	probably damaging	Het

Other mutations in Chd4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00573:Chd4	APN	6	125109897	missense	probably damaging	1.00
IGL00917:Chd4	APN	6	125104946	missense	possibly damaging	0.95
IGL01088:Chd4	APN	6	125122468	unclassified	probably benign
IGL02005:Chd4	APN	6	125128816	missense	possibly damaging	0.71
IGL02405:Chd4	APN	6	125097227	missense	probably benign	0.06
IGL02707:Chd4	APN	6	125108767	missense	probably damaging	1.00
IGL02976:Chd4	APN	6	125121368	missense	probably damaging	1.00
IGL03001:Chd4	APN	6	125101566	missense	possibly damaging	0.93
FR4304:Chd4	UTSW	6	125122144	unclassified	probably benign
FR4589:Chd4	UTSW	6	125122133	missense	probably benign	0.02
FR4589:Chd4	UTSW	6	125122139	unclassified	probably benign
FR4737:Chd4	UTSW	6	125122131	unclassified	probably benign
FR4976:Chd4	UTSW	6	125122131	unclassified	probably benign
R0311:Chd4	UTSW	6	125101665	missense	probably benign	0.15
R0414:Chd4	UTSW	6	125107480	missense	probably damaging	1.00
R0647:Chd4	UTSW	6	125109123	missense	probably damaging	1.00
R0656:Chd4	UTSW	6	125102967	missense	probably damaging	0.98
R1342:Chd4	UTSW	6	125097188	missense	probably benign	0.40
R1651:Chd4	UTSW	6	125123584	missense	possibly damaging	0.92
R1850:Chd4	UTSW	6	125121656	missense	probably damaging	1.00
R2190:Chd4	UTSW	6	125114297	missense	probably benign	0.18
R2192:Chd4	UTSW	6	125105357	missense	probably damaging	0.99
R2858:Chd4	UTSW	6	125104886	missense	probably damaging	0.99
R3406:Chd4	UTSW	6	125122007	missense	probably benign	0.09
R3431:Chd4	UTSW	6	125120560	splice site	probably benign
R4330:Chd4	UTSW	6	125101602	missense	probably benign	0.29
R4394:Chd4	UTSW	6	125121618	missense	probably damaging	0.99
R4538:Chd4	UTSW	6	125120686	missense	probably damaging	0.99
R4664:Chd4	UTSW	6	125101502	missense	possibly damaging	0.58
R4805:Chd4	UTSW	6	125128945	missense	possibly damaging	0.86
R5050:Chd4	UTSW	6	125107480	missense	probably damaging	1.00
R5055:Chd4	UTSW	6	125100986	missense	possibly damaging	0.65
R5232:Chd4	UTSW	6	125121310	missense	probably damaging	1.00
R5314:Chd4	UTSW	6	125100588	missense	probably damaging	0.96
R5343:Chd4	UTSW	6	125120363	missense	probably damaging	1.00
R5502:Chd4	UTSW	6	125105276	missense	possibly damaging	0.83
R5613:Chd4	UTSW	6	125120546	missense	probably damaging	0.99
R6211:Chd4	UTSW	6	125101285	missense	possibly damaging	0.82
R6606:Chd4	UTSW	6	125109426	missense	probably damaging	0.99
R6808:Chd4	UTSW	6	125122123	missense	possibly damaging	0.53
R6939:Chd4	UTSW	6	125106538	missense	probably damaging	0.99
R6968:Chd4	UTSW	6	125108318	missense	probably damaging	1.00
R6973:Chd4	UTSW	6	125122862	missense	possibly damaging	0.53
R6992:Chd4	UTSW	6	125114376	missense	probably benign	0.14
R7058:Chd4	UTSW	6	125108442	missense	possibly damaging	0.74
R7081:Chd4	UTSW	6	125129985	missense	unknown
R7253:Chd4	UTSW	6	125106592	splice site	probably null
R7423:Chd4	UTSW	6	125128859	missense	possibly damaging	0.92
R7535:Chd4	UTSW	6	125128873	missense	probably benign	0.32
R7566:Chd4	UTSW	6	125101903	missense	possibly damaging	0.86
R8053:Chd4	UTSW	6	125128816	nonsense	probably null
R8155:Chd4	UTSW	6	125105324	missense	probably benign	0.00
R8711:Chd4	UTSW	6	125123522	unclassified	probably benign
R8783:Chd4	UTSW	6	125123384	missense	possibly damaging	0.53
R9020:Chd4	UTSW	6	125107506	missense	probably damaging	1.00
R9093:Chd4	UTSW	6	125114011	missense	probably benign	0.13
R9417:Chd4	UTSW	6	125120725	missense	probably damaging	0.99
R9509:Chd4	UTSW	6	125122522	missense	possibly damaging	0.96
RF046:Chd4	UTSW	6	125122131	unclassified	probably benign
RF052:Chd4	UTSW	6	125122145	unclassified	probably benign
RF058:Chd4	UTSW	6	125122131	unclassified	probably benign
RF060:Chd4	UTSW	6	125122145	unclassified	probably benign
X0025:Chd4	UTSW	6	125106467	nonsense	probably null
X0027:Chd4	UTSW	6	125102164	missense	probably damaging	0.98
X0063:Chd4	UTSW	6	125114015	missense	probably damaging	1.00
Z1176:Chd4	UTSW	6	125100860	missense	possibly damaging	0.93
Z1176:Chd4	UTSW	6	125101598	missense	probably benign	0.36

Predicted Primers

PCR Primer
(F):5'- GGCACTGAGGAGCTATTCAAGG -3'
(R):5'- AAGAACAGCACTGCCTTGGAC -3'

Sequencing Primer
(F):5'- TTCAAGGATGAAGCCACGG -3'
(R):5'- GCACTGCCTTGGACCCATAC -3'

Posted On

2018-08-01