Incidental Mutation 'R6753:Zfp868'
ID 530893
Institutional Source Beutler Lab
Gene Symbol Zfp868
Ensembl Gene ENSMUSG00000060427
Gene Name zinc finger protein 868
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R6753 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 69610857-69625548 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 69612096 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 196 (N196S)
Ref Sequence ENSEMBL: ENSMUSP00000113952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074982] [ENSMUST00000121886]
AlphaFold Q3UTQ6
Predicted Effect probably benign
Transcript: ENSMUST00000074982
AA Change: N196S

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000074510
Gene: ENSMUSG00000060427
AA Change: N196S

DomainStartEndE-ValueType
KRAB 16 73 1.37e-12 SMART
low complexity region 83 94 N/A INTRINSIC
ZnF_C2H2 155 177 1.06e-4 SMART
ZnF_C2H2 183 205 1.1e-2 SMART
ZnF_C2H2 211 233 7.78e-3 SMART
ZnF_C2H2 239 261 1.36e-2 SMART
ZnF_C2H2 266 288 2.75e-3 SMART
ZnF_C2H2 294 316 4.79e-3 SMART
ZnF_C2H2 322 344 3.89e-3 SMART
ZnF_C2H2 350 372 5.5e-3 SMART
ZnF_C2H2 378 400 3.21e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121886
AA Change: N196S

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113952
Gene: ENSMUSG00000060427
AA Change: N196S

DomainStartEndE-ValueType
KRAB 16 73 1.37e-12 SMART
low complexity region 83 94 N/A INTRINSIC
ZnF_C2H2 155 177 1.06e-4 SMART
ZnF_C2H2 183 205 1.1e-2 SMART
ZnF_C2H2 211 233 7.78e-3 SMART
ZnF_C2H2 239 261 1.36e-2 SMART
ZnF_C2H2 266 288 2.75e-3 SMART
ZnF_C2H2 294 316 4.79e-3 SMART
ZnF_C2H2 322 344 3.89e-3 SMART
ZnF_C2H2 350 372 5.5e-3 SMART
ZnF_C2H2 378 400 3.21e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150118
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G A 11: 120,010,151 P1083S probably benign Het
Abcb5 T A 12: 118,944,906 N101I possibly damaging Het
Adrb2 A G 18: 62,179,553 V67A possibly damaging Het
Agk T A 6: 40,368,570 probably null Het
Akap10 A T 11: 61,886,777 M586K probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Armc1 A G 3: 19,144,398 F133L possibly damaging Het
Bank1 T C 3: 136,093,308 E424G probably damaging Het
Cacna1a A G 8: 84,580,205 E1363G probably damaging Het
Cacna1d C A 14: 30,042,786 A2076S probably damaging Het
Ccdc73 T A 2: 104,991,524 L606* probably null Het
Ccdc8 C T 7: 16,996,637 Q684* probably null Het
Ces1b T A 8: 93,067,020 K314* probably null Het
Ces1e T A 8: 93,215,128 N238I probably damaging Het
Chd4 A G 6: 125,114,300 N1238S probably benign Het
Cmtr2 T A 8: 110,222,979 D640E probably damaging Het
Col7a1 C T 9: 108,958,128 T559I unknown Het
Comt T C 16: 18,408,021 K205R probably benign Het
Dbp A T 7: 45,708,404 E232V probably damaging Het
Dcbld2 A G 16: 58,456,130 T470A possibly damaging Het
Eml6 T A 11: 29,754,987 D1519V probably damaging Het
Evpl T A 11: 116,237,906 H31L possibly damaging Het
Exoc1 T A 5: 76,563,339 I86N probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fgfr3 T C 5: 33,732,159 S301P probably benign Het
Gas2l1 C T 11: 5,064,254 V69I probably damaging Het
Gm2042 T A 12: 87,958,084 I107K probably damaging Het
Gucy1b1 T C 3: 82,039,747 D385G probably null Het
Ints1 T A 5: 139,765,175 E824D probably damaging Het
Itfg1 T C 8: 85,835,078 D142G probably benign Het
Jaml A G 9: 45,107,379 N359D probably benign Het
Kcnh7 T A 2: 62,850,377 I289L probably benign Het
Klf12 G A 14: 100,109,776 Q40* probably null Het
Mcm4 A C 16: 15,629,362 N579K possibly damaging Het
Mfsd2b A T 12: 4,867,358 F179I possibly damaging Het
Mmp11 C T 10: 75,928,374 V86M probably damaging Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Narf T A 11: 121,242,626 H84Q probably benign Het
Olfr987 C A 2: 85,331,798 M33I probably benign Het
Otog A C 7: 46,249,071 E204D probably benign Het
Parp8 G A 13: 116,895,115 H354Y possibly damaging Het
Pcnx C A 12: 81,964,480 D1238E probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pkd1l3 C T 8: 109,624,449 T642I probably damaging Het
Pkhd1l1 G A 15: 44,589,663 E3995K probably benign Het
Prdm9 A T 17: 15,544,956 Y521N probably benign Het
Prex2 A G 1: 11,184,456 S1105G probably damaging Het
Prss35 T A 9: 86,756,100 F308I probably damaging Het
Rab22a C T 2: 173,701,055 A167V probably benign Het
Rims2 A G 15: 39,566,973 Q871R possibly damaging Het
Rorb A T 19: 18,957,247 M253K probably benign Het
Ryr3 T C 2: 112,652,610 D4269G probably damaging Het
Snx11 T C 11: 96,769,906 probably benign Het
Son A G 16: 91,657,188 Q941R probably damaging Het
Sptbn2 G T 19: 4,747,785 R1880L probably benign Het
Sun1 G A 5: 139,215,259 probably null Het
Tprn A G 2: 25,264,038 R451G probably benign Het
Trbv30 T A 6: 41,281,377 M1K probably null Het
Ttn C A 2: 76,738,221 G25697W probably damaging Het
Ubb T G 11: 62,551,527 probably null Het
Unc13b C T 4: 43,239,331 R1038C probably damaging Het
Usp7 T C 16: 8,696,911 M687V probably benign Het
Zfp160 G A 17: 21,020,734 M21I probably benign Het
Zufsp A T 10: 33,928,029 I483N probably damaging Het
Other mutations in Zfp868
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03166:Zfp868 APN 8 69612314 missense probably damaging 0.99
R0546:Zfp868 UTSW 8 69612231 missense probably benign 0.00
R1706:Zfp868 UTSW 8 69612409 missense probably benign 0.27
R1741:Zfp868 UTSW 8 69611868 missense probably damaging 1.00
R2119:Zfp868 UTSW 8 69611995 nonsense probably null
R2336:Zfp868 UTSW 8 69613907 splice site probably null
R3161:Zfp868 UTSW 8 69612085 missense probably benign 0.01
R5847:Zfp868 UTSW 8 69611652 missense probably damaging 1.00
R6361:Zfp868 UTSW 8 69611913 missense probably damaging 1.00
R6855:Zfp868 UTSW 8 69611579 missense probably damaging 1.00
R8310:Zfp868 UTSW 8 69613795 missense probably damaging 1.00
R8420:Zfp868 UTSW 8 69611509 missense probably damaging 1.00
R8458:Zfp868 UTSW 8 69611908 missense possibly damaging 0.57
R9066:Zfp868 UTSW 8 69611641 missense probably damaging 1.00
Z1088:Zfp868 UTSW 8 69611910 frame shift probably null
Z1176:Zfp868 UTSW 8 69612324 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TAAAGGAACTCTGCCGGCTG -3'
(R):5'- TGGCCATCACAACTATGAGTACAAAG -3'

Sequencing Primer
(F):5'- CTGACGTGTAAAGGCTTTTCCACAG -3'
(R):5'- TCACAACTATGAGTACAAAGAGTGTG -3'
Posted On 2018-08-01