Incidental Mutation 'R6753:Eml6'
ID 530908
Institutional Source Beutler Lab
Gene Symbol Eml6
Ensembl Gene ENSMUSG00000044072
Gene Name echinoderm microtubule associated protein like 6
Synonyms 2900083P10Rik, C230094A16Rik
MMRRC Submission 044870-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.204) question?
Stock # R6753 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 29693048-29976033 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 29704987 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 1519 (D1519V)
Ref Sequence ENSEMBL: ENSMUSP00000051080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058902] [ENSMUST00000137689]
AlphaFold Q5SQM0
Predicted Effect probably damaging
Transcript: ENSMUST00000058902
AA Change: D1519V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051080
Gene: ENSMUSG00000044072
AA Change: D1519V

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
WD40 49 91 1.79e-1 SMART
WD40 94 136 1.42e-4 SMART
WD40 139 178 5.31e-4 SMART
WD40 184 224 8.84e1 SMART
WD40 225 263 3.75e-4 SMART
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.22e0 SMART
WD40 397 436 1.72e0 SMART
WD40 505 546 1.7e2 SMART
WD40 552 592 4.55e-3 SMART
low complexity region 613 625 N/A INTRINSIC
Pfam:HELP 653 715 1.9e-22 PFAM
WD40 716 757 9.24e-1 SMART
WD40 760 802 6.53e-4 SMART
WD40 805 844 2.98e-1 SMART
WD40 856 891 8.52e1 SMART
WD40 892 929 2.09e-2 SMART
WD40 986 1026 1.18e-1 SMART
WD40 1032 1068 3.44e0 SMART
WD40 1071 1111 2.58e-1 SMART
WD40 1180 1221 9.24e-1 SMART
WD40 1227 1267 3.85e-1 SMART
low complexity region 1280 1291 N/A INTRINSIC
Pfam:HELP 1329 1402 5e-15 PFAM
WD40 1404 1447 2.66e0 SMART
WD40 1450 1492 1.85e0 SMART
WD40 1495 1534 2.97e0 SMART
WD40 1543 1582 7.1e1 SMART
WD40 1584 1629 9.51e1 SMART
WD40 1675 1715 3.05e-4 SMART
WD40 1718 1758 8.84e1 SMART
WD40 1759 1798 7.16e-1 SMART
WD40 1869 1910 1.53e1 SMART
WD40 1916 1956 4.62e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123881
Predicted Effect probably benign
Transcript: ENSMUST00000137689
SMART Domains Protein: ENSMUSP00000116197
Gene: ENSMUSG00000044072

DomainStartEndE-ValueType
SCOP:d2bbkh_ 14 72 9e-8 SMART
Blast:WD40 22 64 1e-24 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142651
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G A 11: 119,900,977 (GRCm39) P1083S probably benign Het
Abcb5 T A 12: 118,908,641 (GRCm39) N101I possibly damaging Het
Adrb2 A G 18: 62,312,624 (GRCm39) V67A possibly damaging Het
Agk T A 6: 40,345,504 (GRCm39) probably null Het
Akap10 A T 11: 61,777,603 (GRCm39) M586K probably damaging Het
Akt3 A T 1: 176,877,756 (GRCm39) Y337* probably null Het
Armc1 A G 3: 19,198,562 (GRCm39) F133L possibly damaging Het
Bank1 T C 3: 135,799,069 (GRCm39) E424G probably damaging Het
Cacna1a A G 8: 85,306,834 (GRCm39) E1363G probably damaging Het
Cacna1d C A 14: 29,764,743 (GRCm39) A2076S probably damaging Het
Ccdc73 T A 2: 104,821,869 (GRCm39) L606* probably null Het
Ccdc8 C T 7: 16,730,562 (GRCm39) Q684* probably null Het
Ces1b T A 8: 93,793,648 (GRCm39) K314* probably null Het
Ces1e T A 8: 93,941,756 (GRCm39) N238I probably damaging Het
Chd4 A G 6: 125,091,263 (GRCm39) N1238S probably benign Het
Cmtr2 T A 8: 110,949,611 (GRCm39) D640E probably damaging Het
Col7a1 C T 9: 108,787,196 (GRCm39) T559I unknown Het
Comt T C 16: 18,226,771 (GRCm39) K205R probably benign Het
Dbp A T 7: 45,357,828 (GRCm39) E232V probably damaging Het
Dcbld2 A G 16: 58,276,493 (GRCm39) T470A possibly damaging Het
Evpl T A 11: 116,128,732 (GRCm39) H31L possibly damaging Het
Exoc1 T A 5: 76,711,186 (GRCm39) I86N probably damaging Het
Fat3 C T 9: 15,826,357 (GRCm39) E4532K possibly damaging Het
Fgfr3 T C 5: 33,889,503 (GRCm39) S301P probably benign Het
Gas2l1 C T 11: 5,014,254 (GRCm39) V69I probably damaging Het
Gm2042 T A 12: 87,924,854 (GRCm39) I107K probably damaging Het
Gucy1b1 T C 3: 81,947,054 (GRCm39) D385G probably null Het
Ints1 T A 5: 139,750,930 (GRCm39) E824D probably damaging Het
Itfg1 T C 8: 86,561,707 (GRCm39) D142G probably benign Het
Jaml A G 9: 45,018,677 (GRCm39) N359D probably benign Het
Kcnh7 T A 2: 62,680,721 (GRCm39) I289L probably benign Het
Klf12 G A 14: 100,347,212 (GRCm39) Q40* probably null Het
Mcm4 A C 16: 15,447,226 (GRCm39) N579K possibly damaging Het
Mfsd2b A T 12: 4,917,358 (GRCm39) F179I possibly damaging Het
Mmp11 C T 10: 75,764,208 (GRCm39) V86M probably damaging Het
Mogs T C 6: 83,092,863 (GRCm39) V101A probably damaging Het
Narf T A 11: 121,133,452 (GRCm39) H84Q probably benign Het
Or5ak4 C A 2: 85,162,142 (GRCm39) M33I probably benign Het
Otog A C 7: 45,898,495 (GRCm39) E204D probably benign Het
Parp8 G A 13: 117,031,651 (GRCm39) H354Y possibly damaging Het
Pcnx1 C A 12: 82,011,254 (GRCm39) D1238E probably damaging Het
Pi4ka A G 16: 17,194,846 (GRCm39) L184P possibly damaging Het
Pkd1l3 C T 8: 110,351,081 (GRCm39) T642I probably damaging Het
Pkhd1l1 G A 15: 44,453,059 (GRCm39) E3995K probably benign Het
Prdm9 A T 17: 15,765,218 (GRCm39) Y521N probably benign Het
Prex2 A G 1: 11,254,680 (GRCm39) S1105G probably damaging Het
Prss35 T A 9: 86,638,153 (GRCm39) F308I probably damaging Het
Rab22a C T 2: 173,542,848 (GRCm39) A167V probably benign Het
Rims2 A G 15: 39,430,369 (GRCm39) Q871R possibly damaging Het
Rorb A T 19: 18,934,611 (GRCm39) M253K probably benign Het
Ryr3 T C 2: 112,482,955 (GRCm39) D4269G probably damaging Het
Snx11 T C 11: 96,660,732 (GRCm39) probably benign Het
Son A G 16: 91,454,076 (GRCm39) Q941R probably damaging Het
Sptbn2 G T 19: 4,797,813 (GRCm39) R1880L probably benign Het
Sun1 G A 5: 139,201,014 (GRCm39) probably null Het
Tprn A G 2: 25,154,050 (GRCm39) R451G probably benign Het
Trbv30 T A 6: 41,258,311 (GRCm39) M1K probably null Het
Ttn C A 2: 76,568,565 (GRCm39) G25697W probably damaging Het
Ubb T G 11: 62,442,353 (GRCm39) probably null Het
Unc13b C T 4: 43,239,331 (GRCm39) R1038C probably damaging Het
Usp7 T C 16: 8,514,775 (GRCm39) M687V probably benign Het
Zfp160 G A 17: 21,240,996 (GRCm39) M21I probably benign Het
Zfp868 T C 8: 70,064,747 (GRCm39) N196S probably benign Het
Zup1 A T 10: 33,804,025 (GRCm39) I483N probably damaging Het
Other mutations in Eml6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Eml6 APN 11 29,800,816 (GRCm39) critical splice donor site probably null
IGL01407:Eml6 APN 11 29,705,021 (GRCm39) nonsense probably null
IGL01434:Eml6 APN 11 29,769,090 (GRCm39) missense probably damaging 1.00
IGL01578:Eml6 APN 11 29,800,870 (GRCm39) missense probably benign 0.02
IGL01780:Eml6 APN 11 29,755,175 (GRCm39) missense probably benign 0.17
IGL01821:Eml6 APN 11 29,771,699 (GRCm39) missense probably benign 0.00
IGL01837:Eml6 APN 11 29,727,055 (GRCm39) missense probably benign 0.00
IGL01904:Eml6 APN 11 29,788,613 (GRCm39) nonsense probably null
IGL01972:Eml6 APN 11 29,788,451 (GRCm39) missense possibly damaging 0.67
IGL02134:Eml6 APN 11 29,709,066 (GRCm39) missense probably benign 0.13
IGL02192:Eml6 APN 11 29,755,743 (GRCm39) missense probably benign 0.00
IGL02377:Eml6 APN 11 29,727,282 (GRCm39) missense probably damaging 0.98
IGL02584:Eml6 APN 11 29,699,387 (GRCm39) missense probably damaging 0.99
IGL02587:Eml6 APN 11 29,734,236 (GRCm39) missense possibly damaging 0.92
IGL02810:Eml6 APN 11 29,799,016 (GRCm39) missense possibly damaging 0.94
IGL02873:Eml6 APN 11 29,830,700 (GRCm39) missense probably benign 0.10
IGL02880:Eml6 APN 11 29,699,959 (GRCm39) missense probably benign 0.03
IGL03289:Eml6 APN 11 29,745,328 (GRCm39) missense possibly damaging 0.49
IGL03301:Eml6 APN 11 29,714,083 (GRCm39) missense probably benign 0.18
IGL03386:Eml6 APN 11 29,699,934 (GRCm39) missense probably benign
IGL03407:Eml6 APN 11 29,856,330 (GRCm39) missense probably damaging 1.00
PIT4453001:Eml6 UTSW 11 29,752,489 (GRCm39) missense probably damaging 1.00
R0125:Eml6 UTSW 11 29,832,088 (GRCm39) missense probably benign 0.19
R0240:Eml6 UTSW 11 29,742,367 (GRCm39) missense possibly damaging 0.84
R0240:Eml6 UTSW 11 29,742,367 (GRCm39) missense possibly damaging 0.84
R0271:Eml6 UTSW 11 29,798,949 (GRCm39) missense possibly damaging 0.48
R0304:Eml6 UTSW 11 29,727,441 (GRCm39) missense probably benign 0.00
R0415:Eml6 UTSW 11 29,699,392 (GRCm39) missense possibly damaging 0.84
R0449:Eml6 UTSW 11 29,843,213 (GRCm39) missense probably benign 0.01
R0538:Eml6 UTSW 11 29,710,010 (GRCm39) splice site probably benign
R0671:Eml6 UTSW 11 29,755,065 (GRCm39) missense probably benign 0.00
R0766:Eml6 UTSW 11 29,781,219 (GRCm39) splice site probably benign
R0800:Eml6 UTSW 11 29,699,877 (GRCm39) missense probably benign 0.08
R0841:Eml6 UTSW 11 29,727,430 (GRCm39) missense probably benign 0.41
R0879:Eml6 UTSW 11 29,800,816 (GRCm39) critical splice donor site probably null
R1061:Eml6 UTSW 11 29,727,267 (GRCm39) missense probably damaging 1.00
R1145:Eml6 UTSW 11 29,727,430 (GRCm39) missense probably benign 0.41
R1145:Eml6 UTSW 11 29,727,430 (GRCm39) missense probably benign 0.41
R1172:Eml6 UTSW 11 29,699,824 (GRCm39) missense possibly damaging 0.54
R1173:Eml6 UTSW 11 29,699,824 (GRCm39) missense possibly damaging 0.54
R1174:Eml6 UTSW 11 29,699,824 (GRCm39) missense possibly damaging 0.54
R1199:Eml6 UTSW 11 29,705,044 (GRCm39) missense possibly damaging 0.93
R1311:Eml6 UTSW 11 29,781,088 (GRCm39) splice site probably benign
R1312:Eml6 UTSW 11 29,781,219 (GRCm39) splice site probably benign
R1355:Eml6 UTSW 11 29,783,085 (GRCm39) missense probably benign 0.03
R1370:Eml6 UTSW 11 29,783,085 (GRCm39) missense probably benign 0.03
R1457:Eml6 UTSW 11 29,974,459 (GRCm39) missense probably damaging 1.00
R1486:Eml6 UTSW 11 29,755,114 (GRCm39) missense possibly damaging 0.83
R1511:Eml6 UTSW 11 29,768,374 (GRCm39) missense probably damaging 1.00
R1532:Eml6 UTSW 11 29,742,256 (GRCm39) splice site probably null
R1642:Eml6 UTSW 11 29,727,001 (GRCm39) critical splice donor site probably null
R1682:Eml6 UTSW 11 29,709,065 (GRCm39) missense probably benign 0.13
R1687:Eml6 UTSW 11 29,783,187 (GRCm39) missense probably damaging 1.00
R1699:Eml6 UTSW 11 29,696,282 (GRCm39) nonsense probably null
R1796:Eml6 UTSW 11 29,831,975 (GRCm39) missense probably benign 0.19
R1797:Eml6 UTSW 11 29,832,041 (GRCm39) missense probably benign 0.09
R1837:Eml6 UTSW 11 29,699,802 (GRCm39) splice site probably null
R1874:Eml6 UTSW 11 29,781,136 (GRCm39) missense probably damaging 0.99
R1967:Eml6 UTSW 11 29,974,545 (GRCm39) missense probably damaging 1.00
R1969:Eml6 UTSW 11 29,783,075 (GRCm39) missense probably benign
R2007:Eml6 UTSW 11 29,798,814 (GRCm39) critical splice donor site probably null
R2012:Eml6 UTSW 11 29,781,128 (GRCm39) missense possibly damaging 0.85
R2198:Eml6 UTSW 11 29,800,935 (GRCm39) missense probably benign 0.01
R2217:Eml6 UTSW 11 29,768,907 (GRCm39) missense probably damaging 1.00
R2218:Eml6 UTSW 11 29,768,907 (GRCm39) missense probably damaging 1.00
R2403:Eml6 UTSW 11 29,752,434 (GRCm39) missense probably benign 0.05
R2520:Eml6 UTSW 11 29,741,993 (GRCm39) missense probably damaging 1.00
R2937:Eml6 UTSW 11 29,783,049 (GRCm39) splice site probably benign
R2938:Eml6 UTSW 11 29,783,049 (GRCm39) splice site probably benign
R3085:Eml6 UTSW 11 29,759,332 (GRCm39) missense probably damaging 0.96
R3236:Eml6 UTSW 11 29,781,097 (GRCm39) critical splice donor site probably null
R3738:Eml6 UTSW 11 29,753,137 (GRCm39) missense probably benign 0.20
R3739:Eml6 UTSW 11 29,753,137 (GRCm39) missense probably benign 0.20
R3752:Eml6 UTSW 11 29,759,360 (GRCm39) missense probably benign 0.06
R3854:Eml6 UTSW 11 29,699,905 (GRCm39) missense possibly damaging 0.76
R3941:Eml6 UTSW 11 29,753,167 (GRCm39) missense probably damaging 0.98
R4034:Eml6 UTSW 11 29,753,137 (GRCm39) missense probably benign 0.20
R4049:Eml6 UTSW 11 29,788,577 (GRCm39) missense probably damaging 1.00
R4108:Eml6 UTSW 11 29,755,136 (GRCm39) missense probably damaging 0.98
R4657:Eml6 UTSW 11 29,755,108 (GRCm39) missense possibly damaging 0.77
R4662:Eml6 UTSW 11 29,727,390 (GRCm39) missense probably damaging 1.00
R4665:Eml6 UTSW 11 29,769,007 (GRCm39) nonsense probably null
R4721:Eml6 UTSW 11 29,788,525 (GRCm39) missense possibly damaging 0.95
R4729:Eml6 UTSW 11 29,783,204 (GRCm39) missense probably damaging 1.00
R4766:Eml6 UTSW 11 29,755,757 (GRCm39) missense probably benign 0.22
R4810:Eml6 UTSW 11 29,705,011 (GRCm39) missense possibly damaging 0.92
R4831:Eml6 UTSW 11 29,727,052 (GRCm39) nonsense probably null
R5035:Eml6 UTSW 11 29,804,187 (GRCm39) missense probably benign 0.00
R5064:Eml6 UTSW 11 29,699,300 (GRCm39) missense probably benign 0.12
R5103:Eml6 UTSW 11 29,800,905 (GRCm39) missense possibly damaging 0.65
R5121:Eml6 UTSW 11 29,694,606 (GRCm39) missense probably benign 0.03
R5161:Eml6 UTSW 11 29,974,467 (GRCm39) missense probably damaging 0.99
R5211:Eml6 UTSW 11 29,804,145 (GRCm39) missense probably benign 0.02
R5268:Eml6 UTSW 11 29,753,108 (GRCm39) missense probably benign 0.15
R5390:Eml6 UTSW 11 29,710,096 (GRCm39) missense probably damaging 1.00
R5529:Eml6 UTSW 11 29,714,126 (GRCm39) missense probably benign 0.04
R6239:Eml6 UTSW 11 29,699,275 (GRCm39) missense probably damaging 1.00
R6326:Eml6 UTSW 11 29,769,066 (GRCm39) missense probably damaging 1.00
R6395:Eml6 UTSW 11 29,759,321 (GRCm39) missense probably benign 0.00
R6476:Eml6 UTSW 11 29,741,971 (GRCm39) critical splice donor site probably null
R6483:Eml6 UTSW 11 29,699,875 (GRCm39) missense probably benign 0.00
R6701:Eml6 UTSW 11 29,735,748 (GRCm39) missense probably damaging 0.98
R6809:Eml6 UTSW 11 29,753,161 (GRCm39) missense probably benign 0.23
R6847:Eml6 UTSW 11 29,768,447 (GRCm39) missense probably benign 0.00
R6855:Eml6 UTSW 11 29,701,381 (GRCm39) splice site probably null
R7168:Eml6 UTSW 11 29,788,529 (GRCm39) missense probably benign 0.01
R7175:Eml6 UTSW 11 29,734,231 (GRCm39) missense probably benign 0.00
R7305:Eml6 UTSW 11 29,727,258 (GRCm39) missense probably benign 0.01
R7615:Eml6 UTSW 11 29,752,501 (GRCm39) missense possibly damaging 0.49
R7692:Eml6 UTSW 11 29,703,085 (GRCm39) missense probably damaging 0.98
R7980:Eml6 UTSW 11 29,783,205 (GRCm39) missense probably damaging 1.00
R8026:Eml6 UTSW 11 29,699,973 (GRCm39) missense possibly damaging 0.63
R8046:Eml6 UTSW 11 29,708,981 (GRCm39) missense probably damaging 0.99
R8049:Eml6 UTSW 11 29,843,201 (GRCm39) missense possibly damaging 0.95
R8114:Eml6 UTSW 11 29,704,910 (GRCm39) missense probably damaging 1.00
R8425:Eml6 UTSW 11 29,705,008 (GRCm39) missense probably benign 0.00
R8799:Eml6 UTSW 11 29,708,981 (GRCm39) missense probably benign 0.11
R8945:Eml6 UTSW 11 29,703,110 (GRCm39) missense probably damaging 0.98
R8977:Eml6 UTSW 11 29,734,182 (GRCm39) missense possibly damaging 0.59
R8986:Eml6 UTSW 11 29,755,181 (GRCm39) missense possibly damaging 0.92
R9088:Eml6 UTSW 11 29,768,424 (GRCm39) missense probably damaging 0.96
R9150:Eml6 UTSW 11 29,755,791 (GRCm39) missense probably benign 0.15
R9209:Eml6 UTSW 11 29,781,175 (GRCm39) missense probably damaging 1.00
R9288:Eml6 UTSW 11 29,788,641 (GRCm39) critical splice acceptor site probably null
R9467:Eml6 UTSW 11 29,769,076 (GRCm39) missense probably damaging 0.99
R9481:Eml6 UTSW 11 29,788,641 (GRCm39) critical splice acceptor site probably null
R9534:Eml6 UTSW 11 29,734,155 (GRCm39) missense possibly damaging 0.45
RF037:Eml6 UTSW 11 29,702,549 (GRCm39) critical splice acceptor site probably benign
RF039:Eml6 UTSW 11 29,702,551 (GRCm39) critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- ATGCTTAAGGGATTCAGGACAC -3'
(R):5'- TAGATGGCCTCCTTGGGATG -3'

Sequencing Primer
(F):5'- CAGGACACTTTTTGAGGAAGTATCTG -3'
(R):5'- AAGGAGCACTGACTTTATTCGG -3'
Posted On 2018-08-01