Mutagenetix > Incidental Mutation

Incidental Mutation 'R6753:Eml6'

530908

Institutional Source

Beutler Lab

Gene Symbol

Eml6

Ensembl Gene

ENSMUSG00000044072

Gene Name

echinoderm microtubule associated protein like 6

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.217) question?

Stock #

R6753 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

29743048-30026033 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 29754987 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 1519 (D1519V)

Ref Sequence

ENSEMBL: ENSMUSP00000051080 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058902] [ENSMUST00000137689]

AlphaFold

Q5SQM0

Predicted Effect

probably damaging
Transcript: ENSMUST00000058902
AA Change: D1519V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000051080
Gene: ENSMUSG00000044072
AA Change: D1519V

Domain	Start	End	E-Value	Type
low complexity region	36	47	N/A	INTRINSIC
WD40	49	91	1.79e-1	SMART
WD40	94	136	1.42e-4	SMART
WD40	139	178	5.31e-4	SMART
WD40	184	224	8.84e1	SMART
WD40	225	263	3.75e-4	SMART
WD40	313	353	4.69e-5	SMART
WD40	356	394	2.22e0	SMART
WD40	397	436	1.72e0	SMART
WD40	505	546	1.7e2	SMART
WD40	552	592	4.55e-3	SMART
low complexity region	613	625	N/A	INTRINSIC
Pfam:HELP	653	715	1.9e-22	PFAM
WD40	716	757	9.24e-1	SMART
WD40	760	802	6.53e-4	SMART
WD40	805	844	2.98e-1	SMART
WD40	856	891	8.52e1	SMART
WD40	892	929	2.09e-2	SMART
WD40	986	1026	1.18e-1	SMART
WD40	1032	1068	3.44e0	SMART
WD40	1071	1111	2.58e-1	SMART
WD40	1180	1221	9.24e-1	SMART
WD40	1227	1267	3.85e-1	SMART
low complexity region	1280	1291	N/A	INTRINSIC
Pfam:HELP	1329	1402	5e-15	PFAM
WD40	1404	1447	2.66e0	SMART
WD40	1450	1492	1.85e0	SMART
WD40	1495	1534	2.97e0	SMART
WD40	1543	1582	7.1e1	SMART
WD40	1584	1629	9.51e1	SMART
WD40	1675	1715	3.05e-4	SMART
WD40	1718	1758	8.84e1	SMART
WD40	1759	1798	7.16e-1	SMART
WD40	1869	1910	1.53e1	SMART
WD40	1916	1956	4.62e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123881

Predicted Effect

probably benign
Transcript: ENSMUST00000137689

SMART Domains

Protein: ENSMUSP00000116197
Gene: ENSMUSG00000044072

Domain	Start	End	E-Value	Type
SCOP:d2bbkh_	14	72	9e-8	SMART
Blast:WD40	22	64	1e-24	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142651

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.1%

Validation Efficiency

99% (68/69)

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	G	A	11: 120,010,151	P1083S	probably benign	Het
Abcb5	T	A	12: 118,944,906	N101I	possibly damaging	Het
Adrb2	A	G	18: 62,179,553	V67A	possibly damaging	Het
Agk	T	A	6: 40,368,570		probably null	Het
Akap10	A	T	11: 61,886,777	M586K	probably damaging	Het
Akt3	A	T	1: 177,050,190	Y337*	probably null	Het
Armc1	A	G	3: 19,144,398	F133L	possibly damaging	Het
Bank1	T	C	3: 136,093,308	E424G	probably damaging	Het
Cacna1a	A	G	8: 84,580,205	E1363G	probably damaging	Het
Cacna1d	C	A	14: 30,042,786	A2076S	probably damaging	Het
Ccdc73	T	A	2: 104,991,524	L606*	probably null	Het
Ccdc8	C	T	7: 16,996,637	Q684*	probably null	Het
Ces1b	T	A	8: 93,067,020	K314*	probably null	Het
Ces1e	T	A	8: 93,215,128	N238I	probably damaging	Het
Chd4	A	G	6: 125,114,300	N1238S	probably benign	Het
Cmtr2	T	A	8: 110,222,979	D640E	probably damaging	Het
Col7a1	C	T	9: 108,958,128	T559I	unknown	Het
Comt	T	C	16: 18,408,021	K205R	probably benign	Het
Dbp	A	T	7: 45,708,404	E232V	probably damaging	Het
Dcbld2	A	G	16: 58,456,130	T470A	possibly damaging	Het
Evpl	T	A	11: 116,237,906	H31L	possibly damaging	Het
Exoc1	T	A	5: 76,563,339	I86N	probably damaging	Het
Fat3	C	T	9: 15,915,061	E4532K	possibly damaging	Het
Fgfr3	T	C	5: 33,732,159	S301P	probably benign	Het
Gas2l1	C	T	11: 5,064,254	V69I	probably damaging	Het
Gm2042	T	A	12: 87,958,084	I107K	probably damaging	Het
Gucy1b1	T	C	3: 82,039,747	D385G	probably null	Het
Ints1	T	A	5: 139,765,175	E824D	probably damaging	Het
Itfg1	T	C	8: 85,835,078	D142G	probably benign	Het
Jaml	A	G	9: 45,107,379	N359D	probably benign	Het
Kcnh7	T	A	2: 62,850,377	I289L	probably benign	Het
Klf12	G	A	14: 100,109,776	Q40*	probably null	Het
Mcm4	A	C	16: 15,629,362	N579K	possibly damaging	Het
Mfsd2b	A	T	12: 4,867,358	F179I	possibly damaging	Het
Mmp11	C	T	10: 75,928,374	V86M	probably damaging	Het
Mogs	T	C	6: 83,115,882	V101A	probably damaging	Het
Narf	T	A	11: 121,242,626	H84Q	probably benign	Het
Olfr987	C	A	2: 85,331,798	M33I	probably benign	Het
Otog	A	C	7: 46,249,071	E204D	probably benign	Het
Parp8	G	A	13: 116,895,115	H354Y	possibly damaging	Het
Pcnx	C	A	12: 81,964,480	D1238E	probably damaging	Het
Pi4ka	A	G	16: 17,376,982	L184P	possibly damaging	Het
Pkd1l3	C	T	8: 109,624,449	T642I	probably damaging	Het
Pkhd1l1	G	A	15: 44,589,663	E3995K	probably benign	Het
Prdm9	A	T	17: 15,544,956	Y521N	probably benign	Het
Prex2	A	G	1: 11,184,456	S1105G	probably damaging	Het
Prss35	T	A	9: 86,756,100	F308I	probably damaging	Het
Rab22a	C	T	2: 173,701,055	A167V	probably benign	Het
Rims2	A	G	15: 39,566,973	Q871R	possibly damaging	Het
Rorb	A	T	19: 18,957,247	M253K	probably benign	Het
Ryr3	T	C	2: 112,652,610	D4269G	probably damaging	Het
Snx11	T	C	11: 96,769,906		probably benign	Het
Son	A	G	16: 91,657,188	Q941R	probably damaging	Het
Sptbn2	G	T	19: 4,747,785	R1880L	probably benign	Het
Sun1	G	A	5: 139,215,259		probably null	Het
Tprn	A	G	2: 25,264,038	R451G	probably benign	Het
Trbv30	T	A	6: 41,281,377	M1K	probably null	Het
Ttn	C	A	2: 76,738,221	G25697W	probably damaging	Het
Ubb	T	G	11: 62,551,527		probably null	Het
Unc13b	C	T	4: 43,239,331	R1038C	probably damaging	Het
Usp7	T	C	16: 8,696,911	M687V	probably benign	Het
Zfp160	G	A	17: 21,020,734	M21I	probably benign	Het
Zfp868	T	C	8: 69,612,096	N196S	probably benign	Het
Zufsp	A	T	10: 33,928,029	I483N	probably damaging	Het

Other mutations in Eml6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01071:Eml6	APN	11	29850816	critical splice donor site	probably null
IGL01407:Eml6	APN	11	29755021	nonsense	probably null
IGL01434:Eml6	APN	11	29819090	missense	probably damaging	1.00
IGL01578:Eml6	APN	11	29850870	missense	probably benign	0.02
IGL01780:Eml6	APN	11	29805175	missense	probably benign	0.17
IGL01821:Eml6	APN	11	29821699	missense	probably benign	0.00
IGL01837:Eml6	APN	11	29777055	missense	probably benign	0.00
IGL01904:Eml6	APN	11	29838613	nonsense	probably null
IGL01972:Eml6	APN	11	29838451	missense	possibly damaging	0.67
IGL02134:Eml6	APN	11	29759066	missense	probably benign	0.13
IGL02192:Eml6	APN	11	29805743	missense	probably benign	0.00
IGL02377:Eml6	APN	11	29777282	missense	probably damaging	0.98
IGL02584:Eml6	APN	11	29749387	missense	probably damaging	0.99
IGL02587:Eml6	APN	11	29784236	missense	possibly damaging	0.92
IGL02810:Eml6	APN	11	29849016	missense	possibly damaging	0.94
IGL02873:Eml6	APN	11	29880700	missense	probably benign	0.10
IGL02880:Eml6	APN	11	29749959	missense	probably benign	0.03
IGL03289:Eml6	APN	11	29795328	missense	possibly damaging	0.49
IGL03301:Eml6	APN	11	29764083	missense	probably benign	0.18
IGL03386:Eml6	APN	11	29749934	missense	probably benign
IGL03407:Eml6	APN	11	29906330	missense	probably damaging	1.00
PIT4453001:Eml6	UTSW	11	29802489	missense	probably damaging	1.00
R0125:Eml6	UTSW	11	29882088	missense	probably benign	0.19
R0240:Eml6	UTSW	11	29792367	missense	possibly damaging	0.84
R0240:Eml6	UTSW	11	29792367	missense	possibly damaging	0.84
R0271:Eml6	UTSW	11	29848949	missense	possibly damaging	0.48
R0304:Eml6	UTSW	11	29777441	missense	probably benign	0.00
R0415:Eml6	UTSW	11	29749392	missense	possibly damaging	0.84
R0449:Eml6	UTSW	11	29893213	missense	probably benign	0.01
R0538:Eml6	UTSW	11	29760010	splice site	probably benign
R0671:Eml6	UTSW	11	29805065	missense	probably benign	0.00
R0766:Eml6	UTSW	11	29831219	splice site	probably benign
R0800:Eml6	UTSW	11	29749877	missense	probably benign	0.08
R0841:Eml6	UTSW	11	29777430	missense	probably benign	0.41
R0879:Eml6	UTSW	11	29850816	critical splice donor site	probably null
R1061:Eml6	UTSW	11	29777267	missense	probably damaging	1.00
R1145:Eml6	UTSW	11	29777430	missense	probably benign	0.41
R1145:Eml6	UTSW	11	29777430	missense	probably benign	0.41
R1172:Eml6	UTSW	11	29749824	missense	possibly damaging	0.54
R1173:Eml6	UTSW	11	29749824	missense	possibly damaging	0.54
R1174:Eml6	UTSW	11	29749824	missense	possibly damaging	0.54
R1199:Eml6	UTSW	11	29755044	missense	possibly damaging	0.93
R1311:Eml6	UTSW	11	29831088	splice site	probably benign
R1312:Eml6	UTSW	11	29831219	splice site	probably benign
R1355:Eml6	UTSW	11	29833085	missense	probably benign	0.03
R1370:Eml6	UTSW	11	29833085	missense	probably benign	0.03
R1457:Eml6	UTSW	11	30024459	missense	probably damaging	1.00
R1486:Eml6	UTSW	11	29805114	missense	possibly damaging	0.83
R1511:Eml6	UTSW	11	29818374	missense	probably damaging	1.00
R1532:Eml6	UTSW	11	29792256	splice site	probably null
R1642:Eml6	UTSW	11	29777001	critical splice donor site	probably null
R1682:Eml6	UTSW	11	29759065	missense	probably benign	0.13
R1687:Eml6	UTSW	11	29833187	missense	probably damaging	1.00
R1699:Eml6	UTSW	11	29746282	nonsense	probably null
R1796:Eml6	UTSW	11	29881975	missense	probably benign	0.19
R1797:Eml6	UTSW	11	29882041	missense	probably benign	0.09
R1837:Eml6	UTSW	11	29749802	splice site	probably null
R1874:Eml6	UTSW	11	29831136	missense	probably damaging	0.99
R1967:Eml6	UTSW	11	30024545	missense	probably damaging	1.00
R1969:Eml6	UTSW	11	29833075	missense	probably benign
R2007:Eml6	UTSW	11	29848814	critical splice donor site	probably null
R2012:Eml6	UTSW	11	29831128	missense	possibly damaging	0.85
R2198:Eml6	UTSW	11	29850935	missense	probably benign	0.01
R2217:Eml6	UTSW	11	29818907	missense	probably damaging	1.00
R2218:Eml6	UTSW	11	29818907	missense	probably damaging	1.00
R2403:Eml6	UTSW	11	29802434	missense	probably benign	0.05
R2520:Eml6	UTSW	11	29791993	missense	probably damaging	1.00
R2937:Eml6	UTSW	11	29833049	splice site	probably benign
R2938:Eml6	UTSW	11	29833049	splice site	probably benign
R3085:Eml6	UTSW	11	29809332	missense	probably damaging	0.96
R3236:Eml6	UTSW	11	29831097	critical splice donor site	probably null
R3738:Eml6	UTSW	11	29803137	missense	probably benign	0.20
R3739:Eml6	UTSW	11	29803137	missense	probably benign	0.20
R3752:Eml6	UTSW	11	29809360	missense	probably benign	0.06
R3854:Eml6	UTSW	11	29749905	missense	possibly damaging	0.76
R3941:Eml6	UTSW	11	29803167	missense	probably damaging	0.98
R4034:Eml6	UTSW	11	29803137	missense	probably benign	0.20
R4049:Eml6	UTSW	11	29838577	missense	probably damaging	1.00
R4108:Eml6	UTSW	11	29805136	missense	probably damaging	0.98
R4657:Eml6	UTSW	11	29805108	missense	possibly damaging	0.77
R4662:Eml6	UTSW	11	29777390	missense	probably damaging	1.00
R4665:Eml6	UTSW	11	29819007	nonsense	probably null
R4721:Eml6	UTSW	11	29838525	missense	possibly damaging	0.95
R4729:Eml6	UTSW	11	29833204	missense	probably damaging	1.00
R4766:Eml6	UTSW	11	29805757	missense	probably benign	0.22
R4810:Eml6	UTSW	11	29755011	missense	possibly damaging	0.92
R4831:Eml6	UTSW	11	29777052	nonsense	probably null
R5035:Eml6	UTSW	11	29854187	missense	probably benign	0.00
R5064:Eml6	UTSW	11	29749300	missense	probably benign	0.12
R5103:Eml6	UTSW	11	29850905	missense	possibly damaging	0.65
R5121:Eml6	UTSW	11	29744606	missense	probably benign	0.03
R5161:Eml6	UTSW	11	30024467	missense	probably damaging	0.99
R5211:Eml6	UTSW	11	29854145	missense	probably benign	0.02
R5268:Eml6	UTSW	11	29803108	missense	probably benign	0.15
R5390:Eml6	UTSW	11	29760096	missense	probably damaging	1.00
R5529:Eml6	UTSW	11	29764126	missense	probably benign	0.04
R6239:Eml6	UTSW	11	29749275	missense	probably damaging	1.00
R6326:Eml6	UTSW	11	29819066	missense	probably damaging	1.00
R6395:Eml6	UTSW	11	29809321	missense	probably benign	0.00
R6476:Eml6	UTSW	11	29791971	critical splice donor site	probably null
R6483:Eml6	UTSW	11	29749875	missense	probably benign	0.00
R6701:Eml6	UTSW	11	29785748	missense	probably damaging	0.98
R6809:Eml6	UTSW	11	29803161	missense	probably benign	0.23
R6847:Eml6	UTSW	11	29818447	missense	probably benign	0.00
R6855:Eml6	UTSW	11	29751381	splice site	probably null
R7168:Eml6	UTSW	11	29838529	missense	probably benign	0.01
R7175:Eml6	UTSW	11	29784231	missense	probably benign	0.00
R7305:Eml6	UTSW	11	29777258	missense	probably benign	0.01
R7615:Eml6	UTSW	11	29802501	missense	possibly damaging	0.49
R7692:Eml6	UTSW	11	29753085	missense	probably damaging	0.98
R7980:Eml6	UTSW	11	29833205	missense	probably damaging	1.00
R8026:Eml6	UTSW	11	29749973	missense	possibly damaging	0.63
R8046:Eml6	UTSW	11	29758981	missense	probably damaging	0.99
R8049:Eml6	UTSW	11	29893201	missense	possibly damaging	0.95
R8114:Eml6	UTSW	11	29754910	missense	probably damaging	1.00
R8425:Eml6	UTSW	11	29755008	missense	probably benign	0.00
R8799:Eml6	UTSW	11	29758981	missense	probably benign	0.11
R8945:Eml6	UTSW	11	29753110	missense	probably damaging	0.98
R8977:Eml6	UTSW	11	29784182	missense	possibly damaging	0.59
R8986:Eml6	UTSW	11	29805181	missense	possibly damaging	0.92
R9088:Eml6	UTSW	11	29818424	missense	probably damaging	0.96
R9150:Eml6	UTSW	11	29805791	missense	probably benign	0.15
R9209:Eml6	UTSW	11	29831175	missense	probably damaging	1.00
R9288:Eml6	UTSW	11	29838641	critical splice acceptor site	probably null
R9467:Eml6	UTSW	11	29819076	missense	probably damaging	0.99
R9481:Eml6	UTSW	11	29838641	critical splice acceptor site	probably null
R9534:Eml6	UTSW	11	29784155	missense	possibly damaging	0.45
RF037:Eml6	UTSW	11	29752549	critical splice acceptor site	probably benign
RF039:Eml6	UTSW	11	29752551	critical splice acceptor site	probably benign

Predicted Primers

PCR Primer
(F):5'- ATGCTTAAGGGATTCAGGACAC -3'
(R):5'- TAGATGGCCTCCTTGGGATG -3'

Sequencing Primer
(F):5'- CAGGACACTTTTTGAGGAAGTATCTG -3'
(R):5'- AAGGAGCACTGACTTTATTCGG -3'

Posted On

2018-08-01