Mutagenetix > Incidental Mutations

Incidental Mutation 'R6753:Evpl'

530912

Institutional Source

Beutler Lab

Gene Symbol

Evpl

Ensembl Gene

ENSMUSG00000034282

Gene Name

envoplakin

Synonyms

210kDa protein

MMRRC Submission

Accession Numbers

Genbank: NM_025276; MGI: 107507

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6753 (G1)

Quality Score

95.0077

Status

Validated

Chromosome

Chromosomal Location

116220559-116238077 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 116237906 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 31 (H31L)

Ref Sequence

ENSEMBL: ENSMUSP00000037850 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037007]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000037007
AA Change: H31L

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000037850
Gene: ENSMUSG00000034282
AA Change: H31L

Domain	Start	End	E-Value	Type
low complexity region	3	30	N/A	INTRINSIC
Blast:SPEC	44	140	1e-16	BLAST
Blast:SPEC	140	226	4e-46	BLAST
SPEC	229	330	2.21e-6	SMART
Blast:SPEC	336	500	7e-68	BLAST
low complexity region	508	525	N/A	INTRINSIC
Blast:SPEC	527	632	4e-41	BLAST
Blast:SPEC	635	746	5e-48	BLAST
Blast:SPEC	753	867	7e-49	BLAST
low complexity region	868	881	N/A	INTRINSIC
low complexity region	933	950	N/A	INTRINSIC
internal_repeat_2	1011	1030	6.54e-6	PROSPERO
internal_repeat_3	1012	1032	1.94e-5	PROSPERO
coiled coil region	1035	1077	N/A	INTRINSIC
low complexity region	1131	1144	N/A	INTRINSIC
low complexity region	1149	1164	N/A	INTRINSIC
PLEC	1186	1227	1.48e2	SMART
low complexity region	1228	1242	N/A	INTRINSIC
coiled coil region	1262	1366	N/A	INTRINSIC
low complexity region	1398	1414	N/A	INTRINSIC
internal_repeat_2	1457	1476	6.54e-6	PROSPERO
internal_repeat_3	1516	1536	1.94e-5	PROSPERO
low complexity region	1595	1617	N/A	INTRINSIC
PLEC	1679	1714	9.19e-4	SMART
PLEC	1729	1764	4.53e1	SMART
low complexity region	1788	1800	N/A	INTRINSIC
PLEC	1819	1856	1.41e-4	SMART
PLEC	1857	1894	5.4e-10	SMART
PLEC	1895	1932	2.7e-10	SMART
PLEC	1933	1970	1.21e-3	SMART
PLEC	1971	2008	1.16e0	SMART

Meta Mutation Damage Score

0.0879

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.1%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plakin family of proteins that forms a component of desmosomes and the epidermal cornified envelope. This gene is located in the tylosis oesophageal cancer locus on chromosome 17q25, and its deletion is associated with both familial and sporadic forms of oesophageal squamous cell carcinoma. Patients suffering from the autoimmune mucocutaneous disorder, paraneoplastic pemphigus, develop antibodies against the encoded protein. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted deletion of this gene are viable and fertile. Surprisingly, cornified envelope assembly is not inhibited and adult homozygotes show no obvious pathological phenotype in skin or other epithelia, despite a slight delay in barrier acquisition during embryonic development. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, other(3)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	G	A	11: 120,010,151	P1083S	probably benign	Het
Abcb5	T	A	12: 118,944,906	N101I	possibly damaging	Het
Adrb2	A	G	18: 62,179,553	V67A	possibly damaging	Het
Agk	T	A	6: 40,368,570		probably null	Het
Akap10	A	T	11: 61,886,777	M586K	probably damaging	Het
Akt3	A	T	1: 177,050,190	Y337*	probably null	Het
Armc1	A	G	3: 19,144,398	F133L	possibly damaging	Het
Bank1	T	C	3: 136,093,308	E424G	probably damaging	Het
Cacna1a	A	G	8: 84,580,205	E1363G	probably damaging	Het
Cacna1d	C	A	14: 30,042,786	A2076S	probably damaging	Het
Ccdc73	T	A	2: 104,991,524	L606*	probably null	Het
Ccdc8	C	T	7: 16,996,637	Q684*	probably null	Het
Ces1b	T	A	8: 93,067,020	K314*	probably null	Het
Ces1e	T	A	8: 93,215,128	N238I	probably damaging	Het
Chd4	A	G	6: 125,114,300	N1238S	probably benign	Het
Cmtr2	T	A	8: 110,222,979	D640E	probably damaging	Het
Col7a1	C	T	9: 108,958,128	T559I	unknown	Het
Comt	T	C	16: 18,408,021	K205R	probably benign	Het
Dbp	A	T	7: 45,708,404	E232V	probably damaging	Het
Dcbld2	A	G	16: 58,456,130	T470A	possibly damaging	Het
Eml6	T	A	11: 29,754,987	D1519V	probably damaging	Het
Exoc1	T	A	5: 76,563,339	I86N	probably damaging	Het
Fat3	C	T	9: 15,915,061	E4532K	possibly damaging	Het
Fgfr3	T	C	5: 33,732,159	S301P	probably benign	Het
Gas2l1	C	T	11: 5,064,254	V69I	probably damaging	Het
Gm2042	T	A	12: 87,958,084	I107K	probably damaging	Het
Gucy1b1	T	C	3: 82,039,747	D385G	probably null	Het
Ints1	T	A	5: 139,765,175	E824D	probably damaging	Het
Itfg1	T	C	8: 85,835,078	D142G	probably benign	Het
Jaml	A	G	9: 45,107,379	N359D	probably benign	Het
Kcnh7	T	A	2: 62,850,377	I289L	probably benign	Het
Klf12	G	A	14: 100,109,776	Q40*	probably null	Het
Mcm4	A	C	16: 15,629,362	N579K	possibly damaging	Het
Mfsd2b	A	T	12: 4,867,358	F179I	possibly damaging	Het
Mmp11	C	T	10: 75,928,374	V86M	probably damaging	Het
Mogs	T	C	6: 83,115,882	V101A	probably damaging	Het
Narf	T	A	11: 121,242,626	H84Q	probably benign	Het
Olfr987	C	A	2: 85,331,798	M33I	probably benign	Het
Otog	A	C	7: 46,249,071	E204D	probably benign	Het
Parp8	G	A	13: 116,895,115	H354Y	possibly damaging	Het
Pcnx	C	A	12: 81,964,480	D1238E	probably damaging	Het
Pi4ka	A	G	16: 17,376,982	L184P	possibly damaging	Het
Pkd1l3	C	T	8: 109,624,449	T642I	probably damaging	Het
Pkhd1l1	G	A	15: 44,589,663	E3995K	probably benign	Het
Prdm9	A	T	17: 15,544,956	Y521N	probably benign	Het
Prex2	A	G	1: 11,184,456	S1105G	probably damaging	Het
Prss35	T	A	9: 86,756,100	F308I	probably damaging	Het
Rab22a	C	T	2: 173,701,055	A167V	probably benign	Het
Rims2	A	G	15: 39,566,973	Q871R	possibly damaging	Het
Rorb	A	T	19: 18,957,247	M253K	probably benign	Het
Ryr3	T	C	2: 112,652,610	D4269G	probably damaging	Het
Snx11	T	C	11: 96,769,906		probably benign	Het
Son	A	G	16: 91,657,188	Q941R	probably damaging	Het
Sptbn2	G	T	19: 4,747,785	R1880L	probably benign	Het
Sun1	G	A	5: 139,215,259		probably null	Het
Tprn	A	G	2: 25,264,038	R451G	probably benign	Het
Trbv30	T	A	6: 41,281,377	M1K	probably null	Het
Ttn	C	A	2: 76,738,221	G25697W	probably damaging	Het
Ubb	T	G	11: 62,551,527		probably null	Het
Unc13b	C	T	4: 43,239,331	R1038C	probably damaging	Het
Usp7	T	C	16: 8,696,911	M687V	probably benign	Het
Zfp160	G	A	17: 21,020,734	M21I	probably benign	Het
Zfp868	T	C	8: 69,612,096	N196S	probably benign	Het
Zufsp	A	T	10: 33,928,029	I483N	probably damaging	Het

Other mutations in Evpl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Evpl	APN	11	116234505	missense	probably benign	0.01
IGL00896:Evpl	APN	11	116222584	nonsense	probably null
IGL00941:Evpl	APN	11	116227901	missense	probably benign	0.06
IGL01443:Evpl	APN	11	116222454	missense	probably damaging	1.00
IGL01523:Evpl	APN	11	116233444	missense	probably damaging	1.00
IGL01957:Evpl	APN	11	116223222	missense	probably damaging	1.00
IGL02124:Evpl	APN	11	116227015	missense	probably benign	0.01
IGL02334:Evpl	APN	11	116231024	nonsense	probably null
IGL02457:Evpl	APN	11	116230113	missense	possibly damaging	0.87
IGL02502:Evpl	APN	11	116222718	missense	probably damaging	1.00
IGL02536:Evpl	APN	11	116221209	missense	probably damaging	1.00
IGL02948:Evpl	APN	11	116221822	missense	probably damaging	1.00
IGL03183:Evpl	APN	11	116221612	missense	probably damaging	0.98
IGL03405:Evpl	APN	11	116227927	missense	possibly damaging	0.89
A4554:Evpl	UTSW	11	116220834	missense	probably damaging	1.00
BB005:Evpl	UTSW	11	116222533	missense	possibly damaging	0.63
BB015:Evpl	UTSW	11	116222533	missense	possibly damaging	0.63
PIT4449001:Evpl	UTSW	11	116233399	missense	possibly damaging	0.87
R0082:Evpl	UTSW	11	116235003	missense	probably damaging	1.00
R0108:Evpl	UTSW	11	116220876	missense	probably damaging	1.00
R0514:Evpl	UTSW	11	116223291	missense	probably damaging	0.99
R0581:Evpl	UTSW	11	116229490	missense	probably benign	0.02
R0727:Evpl	UTSW	11	116232485	missense	probably damaging	1.00
R0791:Evpl	UTSW	11	116227723	missense	probably damaging	1.00
R0792:Evpl	UTSW	11	116227723	missense	probably damaging	1.00
R1079:Evpl	UTSW	11	116230068	missense	possibly damaging	0.48
R1514:Evpl	UTSW	11	116223835	missense	probably benign
R1699:Evpl	UTSW	11	116227588	missense	probably damaging	1.00
R1717:Evpl	UTSW	11	116225492	missense	probably benign	0.06
R1775:Evpl	UTSW	11	116223660	missense	possibly damaging	0.66
R1886:Evpl	UTSW	11	116227576	missense	probably damaging	0.97
R1903:Evpl	UTSW	11	116227028	missense	probably damaging	1.00
R2081:Evpl	UTSW	11	116234266	missense	probably damaging	1.00
R2137:Evpl	UTSW	11	116221839	missense	probably damaging	0.99
R2571:Evpl	UTSW	11	116237969	missense	unknown
R3081:Evpl	UTSW	11	116220852	missense	probably damaging	1.00
R4097:Evpl	UTSW	11	116223177	missense	possibly damaging	0.89
R4541:Evpl	UTSW	11	116232644	missense	probably benign	0.01
R4562:Evpl	UTSW	11	116233399	missense	possibly damaging	0.87
R4703:Evpl	UTSW	11	116222505	missense	probably damaging	0.98
R4947:Evpl	UTSW	11	116223375	missense	possibly damaging	0.88
R5243:Evpl	UTSW	11	116222969	missense	probably damaging	1.00
R5325:Evpl	UTSW	11	116221365	missense	probably damaging	1.00
R5416:Evpl	UTSW	11	116234259	missense	probably benign	0.13
R5580:Evpl	UTSW	11	116234232	missense	probably benign	0.14
R5873:Evpl	UTSW	11	116234432	missense	probably damaging	1.00
R6298:Evpl	UTSW	11	116230922	missense	probably damaging	1.00
R6438:Evpl	UTSW	11	116230101	missense	probably benign	0.00
R6742:Evpl	UTSW	11	116222814	missense	possibly damaging	0.80
R6764:Evpl	UTSW	11	116222944	missense	probably damaging	0.99
R6846:Evpl	UTSW	11	116223807	missense	probably damaging	1.00
R7278:Evpl	UTSW	11	116223113	missense	probably damaging	1.00
R7288:Evpl	UTSW	11	116223949	missense	probably benign
R7395:Evpl	UTSW	11	116227079	missense	possibly damaging	0.94
R7441:Evpl	UTSW	11	116222956	nonsense	probably null
R7505:Evpl	UTSW	11	116226987	critical splice donor site	probably null
R7674:Evpl	UTSW	11	116222568	missense	probably benign	0.40
R7772:Evpl	UTSW	11	116221435	missense	probably benign	0.00
R7780:Evpl	UTSW	11	116234174	missense	not run
R7861:Evpl	UTSW	11	116228069	missense	probably damaging	1.00
R7928:Evpl	UTSW	11	116222533	missense	possibly damaging	0.63
R8008:Evpl	UTSW	11	116230472	missense	probably null	0.21
R8040:Evpl	UTSW	11	116222932	missense	probably damaging	0.99
R8052:Evpl	UTSW	11	116223163	missense	probably benign	0.00
R8402:Evpl	UTSW	11	116225371	missense	probably benign	0.03
R8513:Evpl	UTSW	11	116229744	critical splice donor site	probably null
R8695:Evpl	UTSW	11	116223663	missense	probably benign	0.02
R8725:Evpl	UTSW	11	116222193	missense	probably benign	0.25
R8749:Evpl	UTSW	11	116229406	missense	probably benign	0.01
R8807:Evpl	UTSW	11	116221027	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCAGGCTATCCATCCCTTG -3'
(R):5'- ACAAGTCCAAACCTCCGTGG -3'

Sequencing Primer
(F):5'- ATCCCTTGCTCAACCTGGG -3'
(R):5'- TCCCAGACTGGTTGTGCAG -3'

Posted On

2018-08-01