Incidental Mutation 'R6753:Mfsd2b'
ID 530915
Institutional Source Beutler Lab
Gene Symbol Mfsd2b
Ensembl Gene ENSMUSG00000037336
Gene Name major facilitator superfamily domain containing 2B
Synonyms Gm1964
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6753 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 4862440-4874359 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 4867358 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 179 (F179I)
Ref Sequence ENSEMBL: ENSMUSP00000117057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045921] [ENSMUST00000085790] [ENSMUST00000137337] [ENSMUST00000147241]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000045921
AA Change: F282I

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000045315
Gene: ENSMUSG00000037336
AA Change: F282I

DomainStartEndE-ValueType
Pfam:MFS_2 33 472 4.6e-74 PFAM
low complexity region 476 490 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000085790
AA Change: F282I

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000082945
Gene: ENSMUSG00000037336
AA Change: F282I

DomainStartEndE-ValueType
Pfam:MFS_2 32 346 2.2e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125344
Predicted Effect possibly damaging
Transcript: ENSMUST00000137337
AA Change: F179I

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117057
Gene: ENSMUSG00000037336
AA Change: F179I

DomainStartEndE-ValueType
Pfam:MFS_2 1 368 1.1e-59 PFAM
low complexity region 373 387 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143446
Predicted Effect probably benign
Transcript: ENSMUST00000147241
SMART Domains Protein: ENSMUSP00000114977
Gene: ENSMUSG00000037336

DomainStartEndE-ValueType
Pfam:MFS_2 33 110 3.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153676
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 99% (68/69)
MGI Phenotype PHENOTYPE: Homozygous KO reduces sphingosine-1-phosphate export from, and increases its accumulation in, red blood cells and platelets, and leads to reduced leukocyte, reticulocyte, and erythrocyte cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G A 11: 120,010,151 P1083S probably benign Het
Abcb5 T A 12: 118,944,906 N101I possibly damaging Het
Adrb2 A G 18: 62,179,553 V67A possibly damaging Het
Agk T A 6: 40,368,570 probably null Het
Akap10 A T 11: 61,886,777 M586K probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Armc1 A G 3: 19,144,398 F133L possibly damaging Het
Bank1 T C 3: 136,093,308 E424G probably damaging Het
Cacna1a A G 8: 84,580,205 E1363G probably damaging Het
Cacna1d C A 14: 30,042,786 A2076S probably damaging Het
Ccdc73 T A 2: 104,991,524 L606* probably null Het
Ccdc8 C T 7: 16,996,637 Q684* probably null Het
Ces1b T A 8: 93,067,020 K314* probably null Het
Ces1e T A 8: 93,215,128 N238I probably damaging Het
Chd4 A G 6: 125,114,300 N1238S probably benign Het
Cmtr2 T A 8: 110,222,979 D640E probably damaging Het
Col7a1 C T 9: 108,958,128 T559I unknown Het
Comt T C 16: 18,408,021 K205R probably benign Het
Dbp A T 7: 45,708,404 E232V probably damaging Het
Dcbld2 A G 16: 58,456,130 T470A possibly damaging Het
Eml6 T A 11: 29,754,987 D1519V probably damaging Het
Evpl T A 11: 116,237,906 H31L possibly damaging Het
Exoc1 T A 5: 76,563,339 I86N probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fgfr3 T C 5: 33,732,159 S301P probably benign Het
Gas2l1 C T 11: 5,064,254 V69I probably damaging Het
Gm2042 T A 12: 87,958,084 I107K probably damaging Het
Gucy1b1 T C 3: 82,039,747 D385G probably null Het
Ints1 T A 5: 139,765,175 E824D probably damaging Het
Itfg1 T C 8: 85,835,078 D142G probably benign Het
Jaml A G 9: 45,107,379 N359D probably benign Het
Kcnh7 T A 2: 62,850,377 I289L probably benign Het
Klf12 G A 14: 100,109,776 Q40* probably null Het
Mcm4 A C 16: 15,629,362 N579K possibly damaging Het
Mmp11 C T 10: 75,928,374 V86M probably damaging Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Narf T A 11: 121,242,626 H84Q probably benign Het
Olfr987 C A 2: 85,331,798 M33I probably benign Het
Otog A C 7: 46,249,071 E204D probably benign Het
Parp8 G A 13: 116,895,115 H354Y possibly damaging Het
Pcnx C A 12: 81,964,480 D1238E probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pkd1l3 C T 8: 109,624,449 T642I probably damaging Het
Pkhd1l1 G A 15: 44,589,663 E3995K probably benign Het
Prdm9 A T 17: 15,544,956 Y521N probably benign Het
Prex2 A G 1: 11,184,456 S1105G probably damaging Het
Prss35 T A 9: 86,756,100 F308I probably damaging Het
Rab22a C T 2: 173,701,055 A167V probably benign Het
Rims2 A G 15: 39,566,973 Q871R possibly damaging Het
Rorb A T 19: 18,957,247 M253K probably benign Het
Ryr3 T C 2: 112,652,610 D4269G probably damaging Het
Snx11 T C 11: 96,769,906 probably benign Het
Son A G 16: 91,657,188 Q941R probably damaging Het
Sptbn2 G T 19: 4,747,785 R1880L probably benign Het
Sun1 G A 5: 139,215,259 probably null Het
Tprn A G 2: 25,264,038 R451G probably benign Het
Trbv30 T A 6: 41,281,377 M1K probably null Het
Ttn C A 2: 76,738,221 G25697W probably damaging Het
Ubb T G 11: 62,551,527 probably null Het
Unc13b C T 4: 43,239,331 R1038C probably damaging Het
Usp7 T C 16: 8,696,911 M687V probably benign Het
Zfp160 G A 17: 21,020,734 M21I probably benign Het
Zfp868 T C 8: 69,612,096 N196S probably benign Het
Zufsp A T 10: 33,928,029 I483N probably damaging Het
Other mutations in Mfsd2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01810:Mfsd2b APN 12 4866469 missense possibly damaging 0.63
IGL03188:Mfsd2b APN 12 4866538 splice site probably null
IGL03339:Mfsd2b APN 12 4874335 start codon destroyed probably null
R0142:Mfsd2b UTSW 12 4866234 missense probably benign 0.11
R1468:Mfsd2b UTSW 12 4870536 nonsense probably null
R1468:Mfsd2b UTSW 12 4870536 nonsense probably null
R1535:Mfsd2b UTSW 12 4870605 missense probably damaging 1.00
R1718:Mfsd2b UTSW 12 4869037 missense probably damaging 1.00
R1894:Mfsd2b UTSW 12 4869155 missense probably damaging 0.99
R2127:Mfsd2b UTSW 12 4867659 missense probably benign 0.01
R2392:Mfsd2b UTSW 12 4865164 missense possibly damaging 0.73
R3737:Mfsd2b UTSW 12 4870578 missense probably damaging 1.00
R3738:Mfsd2b UTSW 12 4870578 missense probably damaging 1.00
R3739:Mfsd2b UTSW 12 4870578 missense probably damaging 1.00
R3956:Mfsd2b UTSW 12 4866848 missense probably damaging 1.00
R4035:Mfsd2b UTSW 12 4870578 missense probably damaging 1.00
R4244:Mfsd2b UTSW 12 4874356 utr 5 prime probably benign
R4595:Mfsd2b UTSW 12 4865807 missense possibly damaging 0.87
R4667:Mfsd2b UTSW 12 4867636 missense probably benign 0.01
R4723:Mfsd2b UTSW 12 4868992 missense probably benign 0.03
R5126:Mfsd2b UTSW 12 4866183 missense probably benign 0.30
R5145:Mfsd2b UTSW 12 4865908 unclassified probably benign
R5890:Mfsd2b UTSW 12 4867651 missense probably damaging 1.00
R5976:Mfsd2b UTSW 12 4866522 missense probably damaging 1.00
R6912:Mfsd2b UTSW 12 4870611 nonsense probably null
R7182:Mfsd2b UTSW 12 4866157 critical splice donor site probably null
R7472:Mfsd2b UTSW 12 4866481 missense probably damaging 1.00
R8429:Mfsd2b UTSW 12 4866487 missense possibly damaging 0.90
R8559:Mfsd2b UTSW 12 4871471 missense possibly damaging 0.63
R8992:Mfsd2b UTSW 12 4871490 missense probably benign
X0062:Mfsd2b UTSW 12 4865170 missense probably benign 0.01
Z1176:Mfsd2b UTSW 12 4866530 critical splice acceptor site probably null
Z1177:Mfsd2b UTSW 12 4865794 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCAGTCACACGAGCTTCAC -3'
(R):5'- AAGTCTGCTGTGCCTAGGAG -3'

Sequencing Primer
(F):5'- GGCACTATGATGTACGCTTGTAATCC -3'
(R):5'- CTGCTGTGCCTAGGAGTGAAG -3'
Posted On 2018-08-01