Incidental Mutation 'R6753:Abcb5'
ID 530918
Institutional Source Beutler Lab
Gene Symbol Abcb5
Ensembl Gene ENSMUSG00000072791
Gene Name ATP-binding cassette, sub-family B member 5
Synonyms 9230106F14Rik
MMRRC Submission 044870-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.177) question?
Stock # R6753 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 118831559-118930156 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 118908641 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 101 (N101I)
Ref Sequence ENSEMBL: ENSMUSP00000046177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035515]
AlphaFold B5X0E4
Predicted Effect possibly damaging
Transcript: ENSMUST00000035515
AA Change: N101I

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000046177
Gene: ENSMUSG00000072791
AA Change: N101I

DomainStartEndE-ValueType
Pfam:ABC_membrane 49 338 1.9e-74 PFAM
AAA 414 606 2.1e-19 SMART
Pfam:ABC_membrane 693 967 7.3e-59 PFAM
Blast:AAA 969 1040 2e-11 BLAST
AAA 1043 1231 8.26e-18 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G A 11: 119,900,977 (GRCm39) P1083S probably benign Het
Adrb2 A G 18: 62,312,624 (GRCm39) V67A possibly damaging Het
Agk T A 6: 40,345,504 (GRCm39) probably null Het
Akap10 A T 11: 61,777,603 (GRCm39) M586K probably damaging Het
Akt3 A T 1: 176,877,756 (GRCm39) Y337* probably null Het
Armc1 A G 3: 19,198,562 (GRCm39) F133L possibly damaging Het
Bank1 T C 3: 135,799,069 (GRCm39) E424G probably damaging Het
Cacna1a A G 8: 85,306,834 (GRCm39) E1363G probably damaging Het
Cacna1d C A 14: 29,764,743 (GRCm39) A2076S probably damaging Het
Ccdc73 T A 2: 104,821,869 (GRCm39) L606* probably null Het
Ccdc8 C T 7: 16,730,562 (GRCm39) Q684* probably null Het
Ces1b T A 8: 93,793,648 (GRCm39) K314* probably null Het
Ces1e T A 8: 93,941,756 (GRCm39) N238I probably damaging Het
Chd4 A G 6: 125,091,263 (GRCm39) N1238S probably benign Het
Cmtr2 T A 8: 110,949,611 (GRCm39) D640E probably damaging Het
Col7a1 C T 9: 108,787,196 (GRCm39) T559I unknown Het
Comt T C 16: 18,226,771 (GRCm39) K205R probably benign Het
Dbp A T 7: 45,357,828 (GRCm39) E232V probably damaging Het
Dcbld2 A G 16: 58,276,493 (GRCm39) T470A possibly damaging Het
Eml6 T A 11: 29,704,987 (GRCm39) D1519V probably damaging Het
Evpl T A 11: 116,128,732 (GRCm39) H31L possibly damaging Het
Exoc1 T A 5: 76,711,186 (GRCm39) I86N probably damaging Het
Fat3 C T 9: 15,826,357 (GRCm39) E4532K possibly damaging Het
Fgfr3 T C 5: 33,889,503 (GRCm39) S301P probably benign Het
Gas2l1 C T 11: 5,014,254 (GRCm39) V69I probably damaging Het
Gm2042 T A 12: 87,924,854 (GRCm39) I107K probably damaging Het
Gucy1b1 T C 3: 81,947,054 (GRCm39) D385G probably null Het
Ints1 T A 5: 139,750,930 (GRCm39) E824D probably damaging Het
Itfg1 T C 8: 86,561,707 (GRCm39) D142G probably benign Het
Jaml A G 9: 45,018,677 (GRCm39) N359D probably benign Het
Kcnh7 T A 2: 62,680,721 (GRCm39) I289L probably benign Het
Klf12 G A 14: 100,347,212 (GRCm39) Q40* probably null Het
Mcm4 A C 16: 15,447,226 (GRCm39) N579K possibly damaging Het
Mfsd2b A T 12: 4,917,358 (GRCm39) F179I possibly damaging Het
Mmp11 C T 10: 75,764,208 (GRCm39) V86M probably damaging Het
Mogs T C 6: 83,092,863 (GRCm39) V101A probably damaging Het
Narf T A 11: 121,133,452 (GRCm39) H84Q probably benign Het
Or5ak4 C A 2: 85,162,142 (GRCm39) M33I probably benign Het
Otog A C 7: 45,898,495 (GRCm39) E204D probably benign Het
Parp8 G A 13: 117,031,651 (GRCm39) H354Y possibly damaging Het
Pcnx1 C A 12: 82,011,254 (GRCm39) D1238E probably damaging Het
Pi4ka A G 16: 17,194,846 (GRCm39) L184P possibly damaging Het
Pkd1l3 C T 8: 110,351,081 (GRCm39) T642I probably damaging Het
Pkhd1l1 G A 15: 44,453,059 (GRCm39) E3995K probably benign Het
Prdm9 A T 17: 15,765,218 (GRCm39) Y521N probably benign Het
Prex2 A G 1: 11,254,680 (GRCm39) S1105G probably damaging Het
Prss35 T A 9: 86,638,153 (GRCm39) F308I probably damaging Het
Rab22a C T 2: 173,542,848 (GRCm39) A167V probably benign Het
Rims2 A G 15: 39,430,369 (GRCm39) Q871R possibly damaging Het
Rorb A T 19: 18,934,611 (GRCm39) M253K probably benign Het
Ryr3 T C 2: 112,482,955 (GRCm39) D4269G probably damaging Het
Snx11 T C 11: 96,660,732 (GRCm39) probably benign Het
Son A G 16: 91,454,076 (GRCm39) Q941R probably damaging Het
Sptbn2 G T 19: 4,797,813 (GRCm39) R1880L probably benign Het
Sun1 G A 5: 139,201,014 (GRCm39) probably null Het
Tprn A G 2: 25,154,050 (GRCm39) R451G probably benign Het
Trbv30 T A 6: 41,258,311 (GRCm39) M1K probably null Het
Ttn C A 2: 76,568,565 (GRCm39) G25697W probably damaging Het
Ubb T G 11: 62,442,353 (GRCm39) probably null Het
Unc13b C T 4: 43,239,331 (GRCm39) R1038C probably damaging Het
Usp7 T C 16: 8,514,775 (GRCm39) M687V probably benign Het
Zfp160 G A 17: 21,240,996 (GRCm39) M21I probably benign Het
Zfp868 T C 8: 70,064,747 (GRCm39) N196S probably benign Het
Zup1 A T 10: 33,804,025 (GRCm39) I483N probably damaging Het
Other mutations in Abcb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Abcb5 APN 12 118,854,345 (GRCm39) missense probably benign 0.03
IGL00092:Abcb5 APN 12 118,892,430 (GRCm39) missense probably benign 0.09
IGL00503:Abcb5 APN 12 118,871,336 (GRCm39) missense probably benign 0.02
IGL00776:Abcb5 APN 12 118,883,589 (GRCm39) missense probably damaging 1.00
IGL01116:Abcb5 APN 12 118,849,911 (GRCm39) missense probably benign
IGL01302:Abcb5 APN 12 118,881,935 (GRCm39) missense probably damaging 1.00
IGL01403:Abcb5 APN 12 118,836,602 (GRCm39) missense probably damaging 1.00
IGL01453:Abcb5 APN 12 118,831,705 (GRCm39) missense probably damaging 1.00
IGL01541:Abcb5 APN 12 118,875,169 (GRCm39) missense probably benign 0.03
IGL01784:Abcb5 APN 12 118,854,399 (GRCm39) missense probably benign 0.14
IGL01967:Abcb5 APN 12 118,831,707 (GRCm39) missense probably damaging 1.00
IGL01987:Abcb5 APN 12 118,891,093 (GRCm39) missense probably damaging 1.00
IGL02104:Abcb5 APN 12 118,904,415 (GRCm39) missense probably damaging 1.00
IGL02161:Abcb5 APN 12 118,838,490 (GRCm39) missense probably benign
IGL02292:Abcb5 APN 12 118,881,932 (GRCm39) missense probably damaging 1.00
IGL02381:Abcb5 APN 12 118,904,413 (GRCm39) missense probably damaging 1.00
IGL02544:Abcb5 APN 12 118,870,003 (GRCm39) splice site probably benign
IGL02685:Abcb5 APN 12 118,869,682 (GRCm39) missense probably damaging 0.99
IGL02824:Abcb5 APN 12 118,854,420 (GRCm39) missense probably benign 0.05
IGL02876:Abcb5 APN 12 118,883,576 (GRCm39) missense probably damaging 1.00
IGL02929:Abcb5 APN 12 118,908,674 (GRCm39) missense probably damaging 0.99
IGL03030:Abcb5 APN 12 118,904,104 (GRCm39) missense possibly damaging 0.93
IGL03062:Abcb5 APN 12 118,899,822 (GRCm39) missense probably benign 0.43
IGL03200:Abcb5 APN 12 118,928,989 (GRCm39) splice site probably benign
IGL03407:Abcb5 APN 12 118,904,111 (GRCm39) missense probably benign 0.01
alphabet UTSW 12 118,854,353 (GRCm39) missense possibly damaging 0.67
google UTSW 12 118,831,665 (GRCm39) missense possibly damaging 0.93
F5770:Abcb5 UTSW 12 118,849,914 (GRCm39) missense probably benign 0.07
PIT4366001:Abcb5 UTSW 12 118,899,833 (GRCm39) missense probably damaging 1.00
PIT4434001:Abcb5 UTSW 12 118,854,422 (GRCm39) missense probably damaging 1.00
R0078:Abcb5 UTSW 12 118,891,129 (GRCm39) missense probably benign
R0219:Abcb5 UTSW 12 118,849,885 (GRCm39) splice site probably benign
R0312:Abcb5 UTSW 12 118,836,572 (GRCm39) missense probably damaging 1.00
R0347:Abcb5 UTSW 12 118,928,986 (GRCm39) splice site probably benign
R0359:Abcb5 UTSW 12 118,904,067 (GRCm39) missense probably damaging 1.00
R0433:Abcb5 UTSW 12 118,841,545 (GRCm39) missense probably benign 0.03
R0582:Abcb5 UTSW 12 118,904,147 (GRCm39) missense probably benign 0.40
R0815:Abcb5 UTSW 12 118,865,184 (GRCm39) splice site probably benign
R0900:Abcb5 UTSW 12 118,904,359 (GRCm39) missense probably damaging 1.00
R0942:Abcb5 UTSW 12 118,869,933 (GRCm39) missense possibly damaging 0.94
R0988:Abcb5 UTSW 12 118,896,310 (GRCm39) missense probably benign 0.36
R1125:Abcb5 UTSW 12 118,875,282 (GRCm39) missense possibly damaging 0.87
R1437:Abcb5 UTSW 12 118,838,497 (GRCm39) missense probably damaging 0.99
R1469:Abcb5 UTSW 12 118,831,681 (GRCm39) missense possibly damaging 0.83
R1469:Abcb5 UTSW 12 118,831,681 (GRCm39) missense possibly damaging 0.83
R1678:Abcb5 UTSW 12 118,929,064 (GRCm39) start gained probably benign
R1726:Abcb5 UTSW 12 118,871,267 (GRCm39) missense possibly damaging 0.95
R1726:Abcb5 UTSW 12 118,838,536 (GRCm39) splice site probably null
R1836:Abcb5 UTSW 12 118,831,696 (GRCm39) missense possibly damaging 0.93
R1934:Abcb5 UTSW 12 118,871,235 (GRCm39) splice site probably null
R1976:Abcb5 UTSW 12 118,854,417 (GRCm39) missense probably benign
R2005:Abcb5 UTSW 12 118,841,562 (GRCm39) missense probably benign 0.15
R2068:Abcb5 UTSW 12 118,904,303 (GRCm39) nonsense probably null
R2181:Abcb5 UTSW 12 118,831,681 (GRCm39) missense possibly damaging 0.83
R2191:Abcb5 UTSW 12 118,831,691 (GRCm39) missense probably damaging 1.00
R3690:Abcb5 UTSW 12 118,836,668 (GRCm39) missense probably damaging 1.00
R3746:Abcb5 UTSW 12 118,838,355 (GRCm39) missense probably damaging 0.99
R3825:Abcb5 UTSW 12 118,865,087 (GRCm39) splice site probably null
R3919:Abcb5 UTSW 12 118,854,353 (GRCm39) missense possibly damaging 0.67
R4049:Abcb5 UTSW 12 118,832,404 (GRCm39) missense probably damaging 0.99
R4409:Abcb5 UTSW 12 118,836,657 (GRCm39) missense probably damaging 0.98
R4606:Abcb5 UTSW 12 118,896,345 (GRCm39) critical splice acceptor site probably null
R4705:Abcb5 UTSW 12 118,929,040 (GRCm39) missense possibly damaging 0.95
R4954:Abcb5 UTSW 12 118,875,169 (GRCm39) missense probably benign 0.03
R4966:Abcb5 UTSW 12 118,850,626 (GRCm39) intron probably benign
R5169:Abcb5 UTSW 12 118,841,552 (GRCm39) nonsense probably null
R5327:Abcb5 UTSW 12 118,875,278 (GRCm39) missense probably benign 0.01
R5333:Abcb5 UTSW 12 118,831,677 (GRCm39) missense probably damaging 1.00
R5366:Abcb5 UTSW 12 118,831,665 (GRCm39) missense possibly damaging 0.93
R5373:Abcb5 UTSW 12 118,850,912 (GRCm39) missense probably damaging 1.00
R5399:Abcb5 UTSW 12 118,875,234 (GRCm39) missense probably benign
R5416:Abcb5 UTSW 12 118,871,331 (GRCm39) missense probably damaging 1.00
R5447:Abcb5 UTSW 12 118,891,061 (GRCm39) missense probably damaging 1.00
R5474:Abcb5 UTSW 12 118,904,425 (GRCm39) missense probably null 1.00
R5566:Abcb5 UTSW 12 118,899,702 (GRCm39) missense probably damaging 0.99
R5685:Abcb5 UTSW 12 118,896,348 (GRCm39) splice site probably null
R5691:Abcb5 UTSW 12 118,890,970 (GRCm39) missense probably damaging 0.99
R5742:Abcb5 UTSW 12 118,881,992 (GRCm39) missense probably damaging 0.96
R5852:Abcb5 UTSW 12 118,891,139 (GRCm39) missense probably damaging 0.99
R5917:Abcb5 UTSW 12 118,832,516 (GRCm39) nonsense probably null
R5994:Abcb5 UTSW 12 118,928,995 (GRCm39) critical splice donor site probably null
R6295:Abcb5 UTSW 12 118,838,379 (GRCm39) missense probably damaging 0.99
R6455:Abcb5 UTSW 12 118,854,284 (GRCm39) critical splice donor site probably null
R6609:Abcb5 UTSW 12 118,892,497 (GRCm39) missense probably damaging 1.00
R6818:Abcb5 UTSW 12 118,865,089 (GRCm39) splice site probably null
R6870:Abcb5 UTSW 12 118,929,000 (GRCm39) missense possibly damaging 0.87
R6944:Abcb5 UTSW 12 118,875,265 (GRCm39) missense probably benign 0.06
R6957:Abcb5 UTSW 12 118,871,270 (GRCm39) missense probably damaging 1.00
R6984:Abcb5 UTSW 12 118,891,012 (GRCm39) missense possibly damaging 0.47
R7021:Abcb5 UTSW 12 118,895,660 (GRCm39) missense probably benign 0.00
R7061:Abcb5 UTSW 12 118,841,509 (GRCm39) missense probably damaging 1.00
R7175:Abcb5 UTSW 12 118,831,611 (GRCm39) missense probably benign 0.00
R7239:Abcb5 UTSW 12 118,892,460 (GRCm39) missense probably benign 0.19
R7267:Abcb5 UTSW 12 118,916,205 (GRCm39) missense probably damaging 1.00
R7303:Abcb5 UTSW 12 118,875,295 (GRCm39) missense probably damaging 0.96
R7396:Abcb5 UTSW 12 118,831,609 (GRCm39) missense probably damaging 1.00
R7605:Abcb5 UTSW 12 118,881,899 (GRCm39) missense probably damaging 1.00
R7989:Abcb5 UTSW 12 118,875,278 (GRCm39) missense probably benign 0.01
R8177:Abcb5 UTSW 12 118,836,525 (GRCm39) missense possibly damaging 0.65
R8296:Abcb5 UTSW 12 118,838,467 (GRCm39) missense probably benign 0.01
R8544:Abcb5 UTSW 12 118,832,461 (GRCm39) missense probably damaging 1.00
R8558:Abcb5 UTSW 12 118,841,566 (GRCm39) missense probably benign 0.07
R8790:Abcb5 UTSW 12 118,831,620 (GRCm39) missense possibly damaging 0.91
R9003:Abcb5 UTSW 12 118,850,013 (GRCm39) missense possibly damaging 0.93
R9038:Abcb5 UTSW 12 118,895,651 (GRCm39) missense probably benign
R9410:Abcb5 UTSW 12 118,869,703 (GRCm39) missense probably benign 0.00
R9497:Abcb5 UTSW 12 118,899,850 (GRCm39) missense probably damaging 0.96
R9666:Abcb5 UTSW 12 118,838,422 (GRCm39) missense probably damaging 0.98
R9682:Abcb5 UTSW 12 118,896,328 (GRCm39) missense probably damaging 0.99
R9756:Abcb5 UTSW 12 118,881,873 (GRCm39) missense probably damaging 0.98
V7580:Abcb5 UTSW 12 118,849,914 (GRCm39) missense probably benign 0.07
Z1176:Abcb5 UTSW 12 118,882,007 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGCTGATCTTTGCACACAC -3'
(R):5'- TGATCCCGTGGCACTGATTTC -3'

Sequencing Primer
(F):5'- GAGGCCAGTCTTTTCCTAAGCAG -3'
(R):5'- ATCCCGTGGCACTGATTTCATTTTC -3'
Posted On 2018-08-01