Mutagenetix > Incidental Mutations

Incidental Mutation 'R6753:Abcb5'

530918

Institutional Source

Beutler Lab

Gene Symbol

Abcb5

Ensembl Gene

ENSMUSG00000072791

Gene Name

ATP-binding cassette, sub-family B (MDR/TAP), member 5

Synonyms

9230106F14Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.163) question?

Stock #

R6753 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

118867824-118966421 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 118944906 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 101 (N101I)

Ref Sequence

ENSEMBL: ENSMUSP00000046177 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035515]

AlphaFold

B5X0E4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035515
AA Change: N101I

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000046177
Gene: ENSMUSG00000072791
AA Change: N101I

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	49	338	1.9e-74	PFAM
AAA	414	606	2.1e-19	SMART
Pfam:ABC_membrane	693	967	7.3e-59	PFAM
Blast:AAA	969	1040	2e-11	BLAST
AAA	1043	1231	8.26e-18	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.1%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	G	A	11: 120,010,151	P1083S	probably benign	Het
Adrb2	A	G	18: 62,179,553	V67A	possibly damaging	Het
Agk	T	A	6: 40,368,570		probably null	Het
Akap10	A	T	11: 61,886,777	M586K	probably damaging	Het
Akt3	A	T	1: 177,050,190	Y337*	probably null	Het
Armc1	A	G	3: 19,144,398	F133L	possibly damaging	Het
Bank1	T	C	3: 136,093,308	E424G	probably damaging	Het
Cacna1a	A	G	8: 84,580,205	E1363G	probably damaging	Het
Cacna1d	C	A	14: 30,042,786	A2076S	probably damaging	Het
Ccdc73	T	A	2: 104,991,524	L606*	probably null	Het
Ccdc8	C	T	7: 16,996,637	Q684*	probably null	Het
Ces1b	T	A	8: 93,067,020	K314*	probably null	Het
Ces1e	T	A	8: 93,215,128	N238I	probably damaging	Het
Chd4	A	G	6: 125,114,300	N1238S	probably benign	Het
Cmtr2	T	A	8: 110,222,979	D640E	probably damaging	Het
Col7a1	C	T	9: 108,958,128	T559I	unknown	Het
Comt	T	C	16: 18,408,021	K205R	probably benign	Het
Dbp	A	T	7: 45,708,404	E232V	probably damaging	Het
Dcbld2	A	G	16: 58,456,130	T470A	possibly damaging	Het
Eml6	T	A	11: 29,754,987	D1519V	probably damaging	Het
Evpl	T	A	11: 116,237,906	H31L	possibly damaging	Het
Exoc1	T	A	5: 76,563,339	I86N	probably damaging	Het
Fat3	C	T	9: 15,915,061	E4532K	possibly damaging	Het
Fgfr3	T	C	5: 33,732,159	S301P	probably benign	Het
Gas2l1	C	T	11: 5,064,254	V69I	probably damaging	Het
Gm2042	T	A	12: 87,958,084	I107K	probably damaging	Het
Gucy1b1	T	C	3: 82,039,747	D385G	probably null	Het
Ints1	T	A	5: 139,765,175	E824D	probably damaging	Het
Itfg1	T	C	8: 85,835,078	D142G	probably benign	Het
Jaml	A	G	9: 45,107,379	N359D	probably benign	Het
Kcnh7	T	A	2: 62,850,377	I289L	probably benign	Het
Klf12	G	A	14: 100,109,776	Q40*	probably null	Het
Mcm4	A	C	16: 15,629,362	N579K	possibly damaging	Het
Mfsd2b	A	T	12: 4,867,358	F179I	possibly damaging	Het
Mmp11	C	T	10: 75,928,374	V86M	probably damaging	Het
Mogs	T	C	6: 83,115,882	V101A	probably damaging	Het
Narf	T	A	11: 121,242,626	H84Q	probably benign	Het
Olfr987	C	A	2: 85,331,798	M33I	probably benign	Het
Otog	A	C	7: 46,249,071	E204D	probably benign	Het
Parp8	G	A	13: 116,895,115	H354Y	possibly damaging	Het
Pcnx	C	A	12: 81,964,480	D1238E	probably damaging	Het
Pi4ka	A	G	16: 17,376,982	L184P	possibly damaging	Het
Pkd1l3	C	T	8: 109,624,449	T642I	probably damaging	Het
Pkhd1l1	G	A	15: 44,589,663	E3995K	probably benign	Het
Prdm9	A	T	17: 15,544,956	Y521N	probably benign	Het
Prex2	A	G	1: 11,184,456	S1105G	probably damaging	Het
Prss35	T	A	9: 86,756,100	F308I	probably damaging	Het
Rab22a	C	T	2: 173,701,055	A167V	probably benign	Het
Rims2	A	G	15: 39,566,973	Q871R	possibly damaging	Het
Rorb	A	T	19: 18,957,247	M253K	probably benign	Het
Ryr3	T	C	2: 112,652,610	D4269G	probably damaging	Het
Snx11	T	C	11: 96,769,906		probably benign	Het
Son	A	G	16: 91,657,188	Q941R	probably damaging	Het
Sptbn2	G	T	19: 4,747,785	R1880L	probably benign	Het
Sun1	G	A	5: 139,215,259		probably null	Het
Tprn	A	G	2: 25,264,038	R451G	probably benign	Het
Trbv30	T	A	6: 41,281,377	M1K	probably null	Het
Ttn	C	A	2: 76,738,221	G25697W	probably damaging	Het
Ubb	T	G	11: 62,551,527		probably null	Het
Unc13b	C	T	4: 43,239,331	R1038C	probably damaging	Het
Usp7	T	C	16: 8,696,911	M687V	probably benign	Het
Zfp160	G	A	17: 21,020,734	M21I	probably benign	Het
Zfp868	T	C	8: 69,612,096	N196S	probably benign	Het
Zufsp	A	T	10: 33,928,029	I483N	probably damaging	Het

Other mutations in Abcb5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Abcb5	APN	12	118890610	missense	probably benign	0.03
IGL00092:Abcb5	APN	12	118928695	missense	probably benign	0.09
IGL00503:Abcb5	APN	12	118907601	missense	probably benign	0.02
IGL00776:Abcb5	APN	12	118919854	missense	probably damaging	1.00
IGL01116:Abcb5	APN	12	118886176	missense	probably benign
IGL01302:Abcb5	APN	12	118918200	missense	probably damaging	1.00
IGL01403:Abcb5	APN	12	118872867	missense	probably damaging	1.00
IGL01453:Abcb5	APN	12	118867970	missense	probably damaging	1.00
IGL01541:Abcb5	APN	12	118911434	missense	probably benign	0.03
IGL01784:Abcb5	APN	12	118890664	missense	probably benign	0.14
IGL01967:Abcb5	APN	12	118867972	missense	probably damaging	1.00
IGL01987:Abcb5	APN	12	118927358	missense	probably damaging	1.00
IGL02104:Abcb5	APN	12	118940680	missense	probably damaging	1.00
IGL02161:Abcb5	APN	12	118874755	missense	probably benign
IGL02292:Abcb5	APN	12	118918197	missense	probably damaging	1.00
IGL02381:Abcb5	APN	12	118940678	missense	probably damaging	1.00
IGL02544:Abcb5	APN	12	118906268	splice site	probably benign
IGL02685:Abcb5	APN	12	118905947	missense	probably damaging	0.99
IGL02824:Abcb5	APN	12	118890685	missense	probably benign	0.05
IGL02876:Abcb5	APN	12	118919841	missense	probably damaging	1.00
IGL02929:Abcb5	APN	12	118944939	missense	probably damaging	0.99
IGL03030:Abcb5	APN	12	118940369	missense	possibly damaging	0.93
IGL03062:Abcb5	APN	12	118936087	missense	probably benign	0.43
IGL03200:Abcb5	APN	12	118965254	splice site	probably benign
IGL03407:Abcb5	APN	12	118940376	missense	probably benign	0.01
alphabet	UTSW	12	118890618	missense	possibly damaging	0.67
google	UTSW	12	118867930	missense	possibly damaging	0.93
F5770:Abcb5	UTSW	12	118886179	missense	probably benign	0.07
PIT4366001:Abcb5	UTSW	12	118936098	missense	probably damaging	1.00
PIT4434001:Abcb5	UTSW	12	118890687	missense	probably damaging	1.00
R0078:Abcb5	UTSW	12	118927394	missense	probably benign
R0219:Abcb5	UTSW	12	118886150	splice site	probably benign
R0312:Abcb5	UTSW	12	118872837	missense	probably damaging	1.00
R0347:Abcb5	UTSW	12	118965251	splice site	probably benign
R0359:Abcb5	UTSW	12	118940332	missense	probably damaging	1.00
R0433:Abcb5	UTSW	12	118877810	missense	probably benign	0.03
R0582:Abcb5	UTSW	12	118940412	missense	probably benign	0.40
R0815:Abcb5	UTSW	12	118901449	splice site	probably benign
R0900:Abcb5	UTSW	12	118940624	missense	probably damaging	1.00
R0942:Abcb5	UTSW	12	118906198	missense	possibly damaging	0.94
R0988:Abcb5	UTSW	12	118932575	missense	probably benign	0.36
R1125:Abcb5	UTSW	12	118911547	missense	possibly damaging	0.87
R1437:Abcb5	UTSW	12	118874762	missense	probably damaging	0.99
R1469:Abcb5	UTSW	12	118867946	missense	possibly damaging	0.83
R1469:Abcb5	UTSW	12	118867946	missense	possibly damaging	0.83
R1678:Abcb5	UTSW	12	118965329	start gained	probably benign
R1726:Abcb5	UTSW	12	118874801	splice site	probably null
R1726:Abcb5	UTSW	12	118907532	missense	possibly damaging	0.95
R1836:Abcb5	UTSW	12	118867961	missense	possibly damaging	0.93
R1934:Abcb5	UTSW	12	118907500	splice site	probably null
R1976:Abcb5	UTSW	12	118890682	missense	probably benign
R2005:Abcb5	UTSW	12	118877827	missense	probably benign	0.15
R2068:Abcb5	UTSW	12	118940568	nonsense	probably null
R2181:Abcb5	UTSW	12	118867946	missense	possibly damaging	0.83
R2191:Abcb5	UTSW	12	118867956	missense	probably damaging	1.00
R3690:Abcb5	UTSW	12	118872933	missense	probably damaging	1.00
R3746:Abcb5	UTSW	12	118874620	missense	probably damaging	0.99
R3825:Abcb5	UTSW	12	118901352	splice site	probably null
R3919:Abcb5	UTSW	12	118890618	missense	possibly damaging	0.67
R4049:Abcb5	UTSW	12	118868669	missense	probably damaging	0.99
R4409:Abcb5	UTSW	12	118872922	missense	probably damaging	0.98
R4606:Abcb5	UTSW	12	118932610	critical splice acceptor site	probably null
R4705:Abcb5	UTSW	12	118965305	missense	possibly damaging	0.95
R4954:Abcb5	UTSW	12	118911434	missense	probably benign	0.03
R4966:Abcb5	UTSW	12	118886891	intron	probably benign
R5169:Abcb5	UTSW	12	118877817	nonsense	probably null
R5327:Abcb5	UTSW	12	118911543	missense	probably benign	0.01
R5333:Abcb5	UTSW	12	118867942	missense	probably damaging	1.00
R5366:Abcb5	UTSW	12	118867930	missense	possibly damaging	0.93
R5373:Abcb5	UTSW	12	118887177	missense	probably damaging	1.00
R5399:Abcb5	UTSW	12	118911499	missense	probably benign
R5416:Abcb5	UTSW	12	118907596	missense	probably damaging	1.00
R5447:Abcb5	UTSW	12	118927326	missense	probably damaging	1.00
R5474:Abcb5	UTSW	12	118940690	missense	probably null	1.00
R5566:Abcb5	UTSW	12	118935967	missense	probably damaging	0.99
R5685:Abcb5	UTSW	12	118932613	splice site	probably null
R5691:Abcb5	UTSW	12	118927235	missense	probably damaging	0.99
R5742:Abcb5	UTSW	12	118918257	missense	probably damaging	0.96
R5852:Abcb5	UTSW	12	118927404	missense	probably damaging	0.99
R5917:Abcb5	UTSW	12	118868781	nonsense	probably null
R5994:Abcb5	UTSW	12	118965260	critical splice donor site	probably null
R6295:Abcb5	UTSW	12	118874644	missense	probably damaging	0.99
R6455:Abcb5	UTSW	12	118890549	critical splice donor site	probably null
R6609:Abcb5	UTSW	12	118928762	missense	probably damaging	1.00
R6818:Abcb5	UTSW	12	118901354	splice site	probably null
R6870:Abcb5	UTSW	12	118965265	missense	possibly damaging	0.87
R6944:Abcb5	UTSW	12	118911530	missense	probably benign	0.06
R6957:Abcb5	UTSW	12	118907535	missense	probably damaging	1.00
R6984:Abcb5	UTSW	12	118927277	missense	possibly damaging	0.47
R7021:Abcb5	UTSW	12	118931925	missense	probably benign	0.00
R7061:Abcb5	UTSW	12	118877774	missense	probably damaging	1.00
R7175:Abcb5	UTSW	12	118867876	missense	probably benign	0.00
R7239:Abcb5	UTSW	12	118928725	missense	probably benign	0.19
R7267:Abcb5	UTSW	12	118952470	missense	probably damaging	1.00
R7303:Abcb5	UTSW	12	118911560	missense	probably damaging	0.96
R7396:Abcb5	UTSW	12	118867874	missense	probably damaging	1.00
R7605:Abcb5	UTSW	12	118918164	missense	probably damaging	1.00
R7989:Abcb5	UTSW	12	118911543	missense	probably benign	0.01
R8177:Abcb5	UTSW	12	118872790	missense	possibly damaging	0.65
R8296:Abcb5	UTSW	12	118874732	missense	probably benign	0.01
R8544:Abcb5	UTSW	12	118868726	missense	probably damaging	1.00
R8558:Abcb5	UTSW	12	118877831	missense	probably benign	0.07
R8790:Abcb5	UTSW	12	118867885	missense	possibly damaging	0.91
R9003:Abcb5	UTSW	12	118886278	missense	possibly damaging	0.93
R9038:Abcb5	UTSW	12	118931916	missense	probably benign
R9410:Abcb5	UTSW	12	118905968	missense	not run
V7580:Abcb5	UTSW	12	118886179	missense	probably benign	0.07
Z1176:Abcb5	UTSW	12	118918272	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATGCTGATCTTTGCACACAC -3'
(R):5'- TGATCCCGTGGCACTGATTTC -3'

Sequencing Primer
(F):5'- GAGGCCAGTCTTTTCCTAAGCAG -3'
(R):5'- ATCCCGTGGCACTGATTTCATTTTC -3'

Posted On

2018-08-01