Incidental Mutation 'R6753:Cacna1d'
ID 530920
Institutional Source Beutler Lab
Gene Symbol Cacna1d
Ensembl Gene ENSMUSG00000015968
Gene Name calcium channel, voltage-dependent, L type, alpha 1D subunit
Synonyms Cacnl1a2, Cchl1a2, C79217, Cchl1a, Cav1.3alpha1, 8430418G19Rik, D-LTCC
MMRRC Submission 044870-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.900) question?
Stock # R6753 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 29761898-30213113 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 29764743 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 2076 (A2076S)
Ref Sequence ENSEMBL: ENSMUSP00000153250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067620] [ENSMUST00000112249] [ENSMUST00000112250] [ENSMUST00000118917] [ENSMUST00000223803] [ENSMUST00000224198] [ENSMUST00000224395] [ENSMUST00000224785]
AlphaFold Q99246
Predicted Effect probably benign
Transcript: ENSMUST00000067620
SMART Domains Protein: ENSMUSP00000065542
Gene: ENSMUSG00000015970

DomainStartEndE-ValueType
Pfam:GMC_oxred_N 43 341 2.4e-98 PFAM
Pfam:Lycopene_cycl 45 110 8.4e-8 PFAM
Pfam:GMC_oxred_C 431 569 2.5e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112249
AA Change: A2041S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107868
Gene: ENSMUSG00000015968
AA Change: A2041S

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
Pfam:Ion_trans 163 405 4.8e-59 PFAM
PDB:4DEY|B 406 502 3e-38 PDB
low complexity region 503 517 N/A INTRINSIC
Pfam:Ion_trans 557 751 5.5e-46 PFAM
low complexity region 766 781 N/A INTRINSIC
low complexity region 819 840 N/A INTRINSIC
Pfam:Ion_trans 921 1151 7.2e-51 PFAM
Pfam:Ion_trans 1239 1448 3.6e-67 PFAM
Pfam:PKD_channel 1285 1455 1.9e-9 PFAM
Blast:EFh 1469 1497 2e-9 BLAST
Ca_chan_IQ 1583 1617 5.05e-16 SMART
low complexity region 1649 1661 N/A INTRINSIC
low complexity region 1722 1728 N/A INTRINSIC
low complexity region 1830 1840 N/A INTRINSIC
low complexity region 1885 1905 N/A INTRINSIC
low complexity region 1921 1936 N/A INTRINSIC
low complexity region 2122 2133 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112250
AA Change: A2063S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107869
Gene: ENSMUSG00000015968
AA Change: A2063S

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
Pfam:Ion_trans 147 439 5.6e-72 PFAM
low complexity region 473 482 N/A INTRINSIC
low complexity region 525 539 N/A INTRINSIC
Pfam:Ion_trans 544 784 2e-56 PFAM
low complexity region 788 803 N/A INTRINSIC
low complexity region 841 862 N/A INTRINSIC
Pfam:Ion_trans 907 1185 2.6e-63 PFAM
Pfam:Ion_trans 1226 1482 1.7e-70 PFAM
Pfam:PKD_channel 1306 1477 1.2e-9 PFAM
Pfam:GPHH 1484 1553 2.3e-38 PFAM
Ca_chan_IQ 1605 1639 5.05e-16 SMART
Pfam:CAC1F_C 1649 2165 1.1e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118917
SMART Domains Protein: ENSMUSP00000112916
Gene: ENSMUSG00000015970

DomainStartEndE-ValueType
Pfam:GMC_oxred_N 43 341 2.4e-98 PFAM
Pfam:Lycopene_cycl 44 109 1.9e-8 PFAM
Pfam:GMC_oxred_C 431 569 5.9e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223573
Predicted Effect possibly damaging
Transcript: ENSMUST00000223803
AA Change: A2041S

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000224198
AA Change: A2076S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000224395
Predicted Effect probably damaging
Transcript: ENSMUST00000224785
AA Change: A2032S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225717
Meta Mutation Damage Score 0.2710 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: This gene encodes a pore-forming subunit of the L-type, voltage-activated calcium channel family. These channels have been found to play a role in heart and smooth muscle contraction and in the transmission of auditory information. Homozygous knockout mice for this gene exhibit deafness and heart defects. These channels have also been linked to mitochondrial oxidative stress in a mouse model of Parkinson's disease. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes for targeted mutations exhibit small size, hypoinsulinemia, glucose intolerance, decreased number and size of pancreatic islets, deafness with degeneration of hair cells, bradycardia, and arrhythmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G A 11: 119,900,977 (GRCm39) P1083S probably benign Het
Abcb5 T A 12: 118,908,641 (GRCm39) N101I possibly damaging Het
Adrb2 A G 18: 62,312,624 (GRCm39) V67A possibly damaging Het
Agk T A 6: 40,345,504 (GRCm39) probably null Het
Akap10 A T 11: 61,777,603 (GRCm39) M586K probably damaging Het
Akt3 A T 1: 176,877,756 (GRCm39) Y337* probably null Het
Armc1 A G 3: 19,198,562 (GRCm39) F133L possibly damaging Het
Bank1 T C 3: 135,799,069 (GRCm39) E424G probably damaging Het
Cacna1a A G 8: 85,306,834 (GRCm39) E1363G probably damaging Het
Ccdc73 T A 2: 104,821,869 (GRCm39) L606* probably null Het
Ccdc8 C T 7: 16,730,562 (GRCm39) Q684* probably null Het
Ces1b T A 8: 93,793,648 (GRCm39) K314* probably null Het
Ces1e T A 8: 93,941,756 (GRCm39) N238I probably damaging Het
Chd4 A G 6: 125,091,263 (GRCm39) N1238S probably benign Het
Cmtr2 T A 8: 110,949,611 (GRCm39) D640E probably damaging Het
Col7a1 C T 9: 108,787,196 (GRCm39) T559I unknown Het
Comt T C 16: 18,226,771 (GRCm39) K205R probably benign Het
Dbp A T 7: 45,357,828 (GRCm39) E232V probably damaging Het
Dcbld2 A G 16: 58,276,493 (GRCm39) T470A possibly damaging Het
Eml6 T A 11: 29,704,987 (GRCm39) D1519V probably damaging Het
Evpl T A 11: 116,128,732 (GRCm39) H31L possibly damaging Het
Exoc1 T A 5: 76,711,186 (GRCm39) I86N probably damaging Het
Fat3 C T 9: 15,826,357 (GRCm39) E4532K possibly damaging Het
Fgfr3 T C 5: 33,889,503 (GRCm39) S301P probably benign Het
Gas2l1 C T 11: 5,014,254 (GRCm39) V69I probably damaging Het
Gm2042 T A 12: 87,924,854 (GRCm39) I107K probably damaging Het
Gucy1b1 T C 3: 81,947,054 (GRCm39) D385G probably null Het
Ints1 T A 5: 139,750,930 (GRCm39) E824D probably damaging Het
Itfg1 T C 8: 86,561,707 (GRCm39) D142G probably benign Het
Jaml A G 9: 45,018,677 (GRCm39) N359D probably benign Het
Kcnh7 T A 2: 62,680,721 (GRCm39) I289L probably benign Het
Klf12 G A 14: 100,347,212 (GRCm39) Q40* probably null Het
Mcm4 A C 16: 15,447,226 (GRCm39) N579K possibly damaging Het
Mfsd2b A T 12: 4,917,358 (GRCm39) F179I possibly damaging Het
Mmp11 C T 10: 75,764,208 (GRCm39) V86M probably damaging Het
Mogs T C 6: 83,092,863 (GRCm39) V101A probably damaging Het
Narf T A 11: 121,133,452 (GRCm39) H84Q probably benign Het
Or5ak4 C A 2: 85,162,142 (GRCm39) M33I probably benign Het
Otog A C 7: 45,898,495 (GRCm39) E204D probably benign Het
Parp8 G A 13: 117,031,651 (GRCm39) H354Y possibly damaging Het
Pcnx1 C A 12: 82,011,254 (GRCm39) D1238E probably damaging Het
Pi4ka A G 16: 17,194,846 (GRCm39) L184P possibly damaging Het
Pkd1l3 C T 8: 110,351,081 (GRCm39) T642I probably damaging Het
Pkhd1l1 G A 15: 44,453,059 (GRCm39) E3995K probably benign Het
Prdm9 A T 17: 15,765,218 (GRCm39) Y521N probably benign Het
Prex2 A G 1: 11,254,680 (GRCm39) S1105G probably damaging Het
Prss35 T A 9: 86,638,153 (GRCm39) F308I probably damaging Het
Rab22a C T 2: 173,542,848 (GRCm39) A167V probably benign Het
Rims2 A G 15: 39,430,369 (GRCm39) Q871R possibly damaging Het
Rorb A T 19: 18,934,611 (GRCm39) M253K probably benign Het
Ryr3 T C 2: 112,482,955 (GRCm39) D4269G probably damaging Het
Snx11 T C 11: 96,660,732 (GRCm39) probably benign Het
Son A G 16: 91,454,076 (GRCm39) Q941R probably damaging Het
Sptbn2 G T 19: 4,797,813 (GRCm39) R1880L probably benign Het
Sun1 G A 5: 139,201,014 (GRCm39) probably null Het
Tprn A G 2: 25,154,050 (GRCm39) R451G probably benign Het
Trbv30 T A 6: 41,258,311 (GRCm39) M1K probably null Het
Ttn C A 2: 76,568,565 (GRCm39) G25697W probably damaging Het
Ubb T G 11: 62,442,353 (GRCm39) probably null Het
Unc13b C T 4: 43,239,331 (GRCm39) R1038C probably damaging Het
Usp7 T C 16: 8,514,775 (GRCm39) M687V probably benign Het
Zfp160 G A 17: 21,240,996 (GRCm39) M21I probably benign Het
Zfp868 T C 8: 70,064,747 (GRCm39) N196S probably benign Het
Zup1 A T 10: 33,804,025 (GRCm39) I483N probably damaging Het
Other mutations in Cacna1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Cacna1d APN 14 29,818,907 (GRCm39) missense probably damaging 0.97
IGL00857:Cacna1d APN 14 30,072,638 (GRCm39) missense possibly damaging 0.83
IGL01015:Cacna1d APN 14 29,773,699 (GRCm39) splice site probably benign
IGL01420:Cacna1d APN 14 29,773,595 (GRCm39) missense probably benign 0.01
IGL01470:Cacna1d APN 14 29,821,099 (GRCm39) missense probably damaging 0.99
IGL01560:Cacna1d APN 14 29,821,163 (GRCm39) missense probably benign 0.00
IGL01617:Cacna1d APN 14 29,824,328 (GRCm39) missense probably damaging 1.00
IGL01820:Cacna1d APN 14 29,764,823 (GRCm39) missense possibly damaging 0.79
IGL01948:Cacna1d APN 14 29,846,751 (GRCm39) missense probably damaging 1.00
IGL02702:Cacna1d APN 14 29,845,490 (GRCm39) nonsense probably null
IGL02864:Cacna1d APN 14 29,773,663 (GRCm39) missense probably benign 0.10
IGL03082:Cacna1d APN 14 29,821,190 (GRCm39) missense probably damaging 1.00
Brisk UTSW 14 29,893,271 (GRCm39) missense possibly damaging 0.91
Troppo UTSW 14 29,845,411 (GRCm39) missense probably damaging 1.00
PIT4651001:Cacna1d UTSW 14 29,900,602 (GRCm39) missense probably damaging 1.00
R0015:Cacna1d UTSW 14 29,836,928 (GRCm39) missense probably benign 0.00
R0015:Cacna1d UTSW 14 29,836,928 (GRCm39) missense probably benign 0.00
R0033:Cacna1d UTSW 14 29,827,446 (GRCm39) missense probably damaging 0.99
R0047:Cacna1d UTSW 14 30,068,747 (GRCm39) splice site probably benign
R0047:Cacna1d UTSW 14 30,068,747 (GRCm39) splice site probably benign
R0051:Cacna1d UTSW 14 29,833,052 (GRCm39) missense probably damaging 1.00
R0051:Cacna1d UTSW 14 29,833,052 (GRCm39) missense probably damaging 1.00
R0067:Cacna1d UTSW 14 29,796,967 (GRCm39) unclassified probably benign
R0067:Cacna1d UTSW 14 29,796,967 (GRCm39) unclassified probably benign
R0238:Cacna1d UTSW 14 29,845,453 (GRCm39) missense probably benign 0.29
R0238:Cacna1d UTSW 14 29,845,453 (GRCm39) missense probably benign 0.29
R0239:Cacna1d UTSW 14 29,845,453 (GRCm39) missense probably benign 0.29
R0239:Cacna1d UTSW 14 29,845,453 (GRCm39) missense probably benign 0.29
R0240:Cacna1d UTSW 14 29,818,926 (GRCm39) missense probably benign 0.00
R0240:Cacna1d UTSW 14 29,818,926 (GRCm39) missense probably benign 0.00
R0284:Cacna1d UTSW 14 29,794,062 (GRCm39) missense probably damaging 1.00
R0416:Cacna1d UTSW 14 29,822,645 (GRCm39) splice site probably benign
R0427:Cacna1d UTSW 14 30,068,774 (GRCm39) missense probably damaging 0.99
R0517:Cacna1d UTSW 14 29,901,232 (GRCm39) missense probably damaging 1.00
R0639:Cacna1d UTSW 14 29,893,251 (GRCm39) critical splice donor site probably null
R0727:Cacna1d UTSW 14 29,852,072 (GRCm39) critical splice donor site probably null
R0732:Cacna1d UTSW 14 29,764,877 (GRCm39) missense probably damaging 0.99
R0843:Cacna1d UTSW 14 29,846,828 (GRCm39) missense probably damaging 1.00
R0900:Cacna1d UTSW 14 29,833,039 (GRCm39) missense probably damaging 1.00
R1278:Cacna1d UTSW 14 29,900,660 (GRCm39) missense probably damaging 1.00
R1340:Cacna1d UTSW 14 29,794,024 (GRCm39) missense probably damaging 0.96
R1527:Cacna1d UTSW 14 29,829,753 (GRCm39) missense probably damaging 1.00
R1711:Cacna1d UTSW 14 29,788,013 (GRCm39) missense probably damaging 1.00
R1736:Cacna1d UTSW 14 29,811,820 (GRCm39) missense probably damaging 1.00
R1763:Cacna1d UTSW 14 29,821,153 (GRCm39) missense probably benign 0.25
R2034:Cacna1d UTSW 14 29,811,820 (GRCm39) missense probably damaging 1.00
R2086:Cacna1d UTSW 14 29,769,314 (GRCm39) missense possibly damaging 0.83
R2126:Cacna1d UTSW 14 29,845,120 (GRCm39) missense probably damaging 1.00
R2218:Cacna1d UTSW 14 29,845,048 (GRCm39) missense probably damaging 1.00
R2219:Cacna1d UTSW 14 29,764,047 (GRCm39) missense probably damaging 1.00
R2262:Cacna1d UTSW 14 30,212,973 (GRCm39) missense possibly damaging 0.46
R2291:Cacna1d UTSW 14 29,764,299 (GRCm39) missense probably damaging 1.00
R2399:Cacna1d UTSW 14 29,774,444 (GRCm39) missense probably benign 0.34
R2424:Cacna1d UTSW 14 29,770,980 (GRCm39) missense probably damaging 0.96
R2568:Cacna1d UTSW 14 29,804,468 (GRCm39) missense probably damaging 0.99
R4038:Cacna1d UTSW 14 29,788,040 (GRCm39) missense probably damaging 0.96
R4509:Cacna1d UTSW 14 29,818,928 (GRCm39) missense probably damaging 1.00
R4649:Cacna1d UTSW 14 29,817,365 (GRCm39) missense probably benign
R4650:Cacna1d UTSW 14 29,817,365 (GRCm39) missense probably benign
R4652:Cacna1d UTSW 14 29,817,365 (GRCm39) missense probably benign
R5009:Cacna1d UTSW 14 29,801,289 (GRCm39) missense probably damaging 1.00
R5058:Cacna1d UTSW 14 29,836,201 (GRCm39) nonsense probably null
R5063:Cacna1d UTSW 14 29,773,340 (GRCm39) missense probably benign
R5138:Cacna1d UTSW 14 30,212,929 (GRCm39) missense probably benign
R5151:Cacna1d UTSW 14 29,845,280 (GRCm39) missense probably damaging 1.00
R5278:Cacna1d UTSW 14 30,074,881 (GRCm39) critical splice donor site probably null
R5286:Cacna1d UTSW 14 30,072,682 (GRCm39) missense possibly damaging 0.69
R5313:Cacna1d UTSW 14 30,068,798 (GRCm39) missense probably benign 0.38
R5383:Cacna1d UTSW 14 29,767,236 (GRCm39) missense possibly damaging 0.51
R5387:Cacna1d UTSW 14 29,822,708 (GRCm39) missense probably damaging 1.00
R5514:Cacna1d UTSW 14 30,072,790 (GRCm39) nonsense probably null
R5524:Cacna1d UTSW 14 29,764,086 (GRCm39) missense probably benign 0.01
R5663:Cacna1d UTSW 14 29,845,297 (GRCm39) missense probably damaging 1.00
R5712:Cacna1d UTSW 14 29,796,954 (GRCm39) missense probably damaging 1.00
R5796:Cacna1d UTSW 14 29,788,073 (GRCm39) missense probably damaging 1.00
R5906:Cacna1d UTSW 14 29,818,917 (GRCm39) missense probably damaging 1.00
R5923:Cacna1d UTSW 14 29,833,105 (GRCm39) missense probably damaging 1.00
R5936:Cacna1d UTSW 14 29,893,271 (GRCm39) missense possibly damaging 0.91
R5938:Cacna1d UTSW 14 29,825,692 (GRCm39) missense probably damaging 1.00
R6041:Cacna1d UTSW 14 29,764,314 (GRCm39) missense probably damaging 1.00
R6432:Cacna1d UTSW 14 29,845,411 (GRCm39) missense probably damaging 1.00
R6486:Cacna1d UTSW 14 29,836,190 (GRCm39) missense probably benign 0.01
R6600:Cacna1d UTSW 14 29,836,192 (GRCm39) missense probably benign 0.15
R6661:Cacna1d UTSW 14 29,811,832 (GRCm39) missense probably damaging 1.00
R6804:Cacna1d UTSW 14 29,773,622 (GRCm39) missense probably benign 0.00
R6851:Cacna1d UTSW 14 29,764,739 (GRCm39) missense probably damaging 1.00
R6863:Cacna1d UTSW 14 29,797,809 (GRCm39) missense probably damaging 1.00
R6916:Cacna1d UTSW 14 29,817,321 (GRCm39) missense probably damaging 1.00
R6925:Cacna1d UTSW 14 29,773,594 (GRCm39) missense probably benign
R7066:Cacna1d UTSW 14 30,074,935 (GRCm39) intron probably benign
R7188:Cacna1d UTSW 14 29,811,790 (GRCm39) missense probably benign
R7242:Cacna1d UTSW 14 29,900,663 (GRCm39) missense probably benign 0.00
R7249:Cacna1d UTSW 14 29,864,660 (GRCm39) missense probably damaging 1.00
R7250:Cacna1d UTSW 14 29,797,108 (GRCm39) missense probably damaging 1.00
R7274:Cacna1d UTSW 14 29,864,600 (GRCm39) missense probably damaging 1.00
R7336:Cacna1d UTSW 14 29,767,239 (GRCm39) missense probably benign 0.18
R7343:Cacna1d UTSW 14 29,845,014 (GRCm39) missense probably benign 0.02
R7411:Cacna1d UTSW 14 30,074,947 (GRCm39) start codon destroyed probably null
R7461:Cacna1d UTSW 14 29,788,120 (GRCm39) missense probably benign 0.05
R7534:Cacna1d UTSW 14 29,801,319 (GRCm39) missense probably damaging 1.00
R7613:Cacna1d UTSW 14 29,788,120 (GRCm39) missense probably benign 0.05
R7661:Cacna1d UTSW 14 29,769,177 (GRCm39) missense probably benign 0.07
R7754:Cacna1d UTSW 14 29,797,809 (GRCm39) missense probably damaging 1.00
R7759:Cacna1d UTSW 14 29,821,145 (GRCm39) missense probably benign 0.01
R7784:Cacna1d UTSW 14 29,845,396 (GRCm39) missense probably damaging 1.00
R7808:Cacna1d UTSW 14 29,833,026 (GRCm39) missense probably damaging 1.00
R7965:Cacna1d UTSW 14 29,769,270 (GRCm39) nonsense probably null
R8225:Cacna1d UTSW 14 29,844,990 (GRCm39) missense probably benign 0.23
R8259:Cacna1d UTSW 14 29,773,475 (GRCm39) missense probably benign
R8348:Cacna1d UTSW 14 29,824,364 (GRCm39) missense probably damaging 1.00
R8448:Cacna1d UTSW 14 29,824,364 (GRCm39) missense probably damaging 1.00
R8822:Cacna1d UTSW 14 29,900,692 (GRCm39) missense probably benign 0.02
R8848:Cacna1d UTSW 14 29,845,283 (GRCm39) missense possibly damaging 0.89
R9122:Cacna1d UTSW 14 29,852,125 (GRCm39) missense probably benign 0.00
R9122:Cacna1d UTSW 14 29,845,402 (GRCm39) missense probably damaging 1.00
R9169:Cacna1d UTSW 14 29,796,873 (GRCm39) missense probably damaging 1.00
R9199:Cacna1d UTSW 14 29,764,893 (GRCm39) missense probably benign 0.26
R9203:Cacna1d UTSW 14 29,773,669 (GRCm39) missense probably benign 0.04
R9263:Cacna1d UTSW 14 29,796,925 (GRCm39) missense probably damaging 1.00
R9346:Cacna1d UTSW 14 29,818,880 (GRCm39) missense possibly damaging 0.86
R9444:Cacna1d UTSW 14 29,829,741 (GRCm39) critical splice donor site probably null
R9487:Cacna1d UTSW 14 29,845,419 (GRCm39) missense possibly damaging 0.90
R9542:Cacna1d UTSW 14 29,845,316 (GRCm39) missense probably benign 0.00
R9651:Cacna1d UTSW 14 29,764,881 (GRCm39) missense probably benign 0.00
R9785:Cacna1d UTSW 14 29,824,300 (GRCm39) critical splice donor site probably null
Z1176:Cacna1d UTSW 14 29,833,073 (GRCm39) missense probably benign 0.15
Z1176:Cacna1d UTSW 14 29,901,145 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGTGCCAGCTGGTTTTCAC -3'
(R):5'- TTCCAGTAAAGCCCAGAAGTACTC -3'

Sequencing Primer
(F):5'- ACTCAGGCCTTAAATGCTGC -3'
(R):5'- ATACCGAGACTGGAGCCCATG -3'
Posted On 2018-08-01