Incidental Mutation 'R6753:Klf12'
ID 530921
Institutional Source Beutler Lab
Gene Symbol Klf12
Ensembl Gene ENSMUSG00000072294
Gene Name Kruppel-like transcription factor 12
Synonyms AP-2rep, 2700063E05Rik, D530033K05Rik, B130052C06Rik
MMRRC Submission 044870-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.449) question?
Stock # R6753 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 100108068-100522115 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 100347212 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 40 (Q40*)
Ref Sequence ENSEMBL: ENSMUSP00000153901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097079] [ENSMUST00000226774] [ENSMUST00000228216]
AlphaFold O35738
Predicted Effect probably null
Transcript: ENSMUST00000097079
AA Change: Q40*
SMART Domains Protein: ENSMUSP00000094844
Gene: ENSMUSG00000072294
AA Change: Q40*

DomainStartEndE-ValueType
low complexity region 89 145 N/A INTRINSIC
low complexity region 183 200 N/A INTRINSIC
ZnF_C2H2 317 341 9.58e-3 SMART
ZnF_C2H2 347 371 8.6e-5 SMART
ZnF_C2H2 377 399 9.58e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000226774
AA Change: Q40*
Predicted Effect probably null
Transcript: ENSMUST00000228216
AA Change: Q40*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Activator protein-2 alpha (AP-2 alpha) is a developmentally-regulated transcription factor and important regulator of gene expression during vertebrate development and carcinogenesis. The protein encoded by this gene is a member of the Kruppel-like zinc finger protein family and can repress expression of the AP-2 alpha gene by binding to a specific site in the AP-2 alpha gene promoter. Repression by the encoded protein requires binding with a corepressor, CtBP1. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(49) : Targeted(1) Gene trapped(48)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G A 11: 119,900,977 (GRCm39) P1083S probably benign Het
Abcb5 T A 12: 118,908,641 (GRCm39) N101I possibly damaging Het
Adrb2 A G 18: 62,312,624 (GRCm39) V67A possibly damaging Het
Agk T A 6: 40,345,504 (GRCm39) probably null Het
Akap10 A T 11: 61,777,603 (GRCm39) M586K probably damaging Het
Akt3 A T 1: 176,877,756 (GRCm39) Y337* probably null Het
Armc1 A G 3: 19,198,562 (GRCm39) F133L possibly damaging Het
Bank1 T C 3: 135,799,069 (GRCm39) E424G probably damaging Het
Cacna1a A G 8: 85,306,834 (GRCm39) E1363G probably damaging Het
Cacna1d C A 14: 29,764,743 (GRCm39) A2076S probably damaging Het
Ccdc73 T A 2: 104,821,869 (GRCm39) L606* probably null Het
Ccdc8 C T 7: 16,730,562 (GRCm39) Q684* probably null Het
Ces1b T A 8: 93,793,648 (GRCm39) K314* probably null Het
Ces1e T A 8: 93,941,756 (GRCm39) N238I probably damaging Het
Chd4 A G 6: 125,091,263 (GRCm39) N1238S probably benign Het
Cmtr2 T A 8: 110,949,611 (GRCm39) D640E probably damaging Het
Col7a1 C T 9: 108,787,196 (GRCm39) T559I unknown Het
Comt T C 16: 18,226,771 (GRCm39) K205R probably benign Het
Dbp A T 7: 45,357,828 (GRCm39) E232V probably damaging Het
Dcbld2 A G 16: 58,276,493 (GRCm39) T470A possibly damaging Het
Eml6 T A 11: 29,704,987 (GRCm39) D1519V probably damaging Het
Evpl T A 11: 116,128,732 (GRCm39) H31L possibly damaging Het
Exoc1 T A 5: 76,711,186 (GRCm39) I86N probably damaging Het
Fat3 C T 9: 15,826,357 (GRCm39) E4532K possibly damaging Het
Fgfr3 T C 5: 33,889,503 (GRCm39) S301P probably benign Het
Gas2l1 C T 11: 5,014,254 (GRCm39) V69I probably damaging Het
Gm2042 T A 12: 87,924,854 (GRCm39) I107K probably damaging Het
Gucy1b1 T C 3: 81,947,054 (GRCm39) D385G probably null Het
Ints1 T A 5: 139,750,930 (GRCm39) E824D probably damaging Het
Itfg1 T C 8: 86,561,707 (GRCm39) D142G probably benign Het
Jaml A G 9: 45,018,677 (GRCm39) N359D probably benign Het
Kcnh7 T A 2: 62,680,721 (GRCm39) I289L probably benign Het
Mcm4 A C 16: 15,447,226 (GRCm39) N579K possibly damaging Het
Mfsd2b A T 12: 4,917,358 (GRCm39) F179I possibly damaging Het
Mmp11 C T 10: 75,764,208 (GRCm39) V86M probably damaging Het
Mogs T C 6: 83,092,863 (GRCm39) V101A probably damaging Het
Narf T A 11: 121,133,452 (GRCm39) H84Q probably benign Het
Or5ak4 C A 2: 85,162,142 (GRCm39) M33I probably benign Het
Otog A C 7: 45,898,495 (GRCm39) E204D probably benign Het
Parp8 G A 13: 117,031,651 (GRCm39) H354Y possibly damaging Het
Pcnx1 C A 12: 82,011,254 (GRCm39) D1238E probably damaging Het
Pi4ka A G 16: 17,194,846 (GRCm39) L184P possibly damaging Het
Pkd1l3 C T 8: 110,351,081 (GRCm39) T642I probably damaging Het
Pkhd1l1 G A 15: 44,453,059 (GRCm39) E3995K probably benign Het
Prdm9 A T 17: 15,765,218 (GRCm39) Y521N probably benign Het
Prex2 A G 1: 11,254,680 (GRCm39) S1105G probably damaging Het
Prss35 T A 9: 86,638,153 (GRCm39) F308I probably damaging Het
Rab22a C T 2: 173,542,848 (GRCm39) A167V probably benign Het
Rims2 A G 15: 39,430,369 (GRCm39) Q871R possibly damaging Het
Rorb A T 19: 18,934,611 (GRCm39) M253K probably benign Het
Ryr3 T C 2: 112,482,955 (GRCm39) D4269G probably damaging Het
Snx11 T C 11: 96,660,732 (GRCm39) probably benign Het
Son A G 16: 91,454,076 (GRCm39) Q941R probably damaging Het
Sptbn2 G T 19: 4,797,813 (GRCm39) R1880L probably benign Het
Sun1 G A 5: 139,201,014 (GRCm39) probably null Het
Tprn A G 2: 25,154,050 (GRCm39) R451G probably benign Het
Trbv30 T A 6: 41,258,311 (GRCm39) M1K probably null Het
Ttn C A 2: 76,568,565 (GRCm39) G25697W probably damaging Het
Ubb T G 11: 62,442,353 (GRCm39) probably null Het
Unc13b C T 4: 43,239,331 (GRCm39) R1038C probably damaging Het
Usp7 T C 16: 8,514,775 (GRCm39) M687V probably benign Het
Zfp160 G A 17: 21,240,996 (GRCm39) M21I probably benign Het
Zfp868 T C 8: 70,064,747 (GRCm39) N196S probably benign Het
Zup1 A T 10: 33,804,025 (GRCm39) I483N probably damaging Het
Other mutations in Klf12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Klf12 APN 14 100,387,193 (GRCm39) missense probably damaging 0.99
IGL01407:Klf12 APN 14 100,347,294 (GRCm39) missense possibly damaging 0.72
IGL01621:Klf12 APN 14 100,260,585 (GRCm39) missense probably damaging 1.00
IGL02746:Klf12 APN 14 100,137,656 (GRCm39) missense probably benign 0.17
IGL02839:Klf12 APN 14 100,137,675 (GRCm39) nonsense probably null
R0034:Klf12 UTSW 14 100,224,865 (GRCm39) critical splice donor site probably null
R0034:Klf12 UTSW 14 100,224,865 (GRCm39) critical splice donor site probably null
R0212:Klf12 UTSW 14 100,260,298 (GRCm39) missense probably benign
R0577:Klf12 UTSW 14 100,260,585 (GRCm39) missense probably damaging 0.99
R1980:Klf12 UTSW 14 100,387,162 (GRCm39) splice site probably null
R2017:Klf12 UTSW 14 100,260,073 (GRCm39) missense possibly damaging 0.87
R2282:Klf12 UTSW 14 100,137,581 (GRCm39) missense probably damaging 0.96
R2317:Klf12 UTSW 14 100,179,503 (GRCm39) missense probably benign 0.00
R2901:Klf12 UTSW 14 100,137,582 (GRCm39) missense probably damaging 0.98
R4946:Klf12 UTSW 14 100,260,393 (GRCm39) missense possibly damaging 0.53
R5386:Klf12 UTSW 14 100,137,595 (GRCm39) missense probably damaging 1.00
R5802:Klf12 UTSW 14 100,260,330 (GRCm39) missense probably benign 0.33
R5903:Klf12 UTSW 14 100,260,124 (GRCm39) missense probably damaging 0.99
R6037:Klf12 UTSW 14 100,137,650 (GRCm39) missense probably benign 0.17
R6037:Klf12 UTSW 14 100,137,650 (GRCm39) missense probably benign 0.17
R8801:Klf12 UTSW 14 100,260,172 (GRCm39) missense probably benign 0.18
R9347:Klf12 UTSW 14 100,260,144 (GRCm39) missense possibly damaging 0.82
R9455:Klf12 UTSW 14 100,347,226 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCACTCAGCCACAAGGGTC -3'
(R):5'- CACTTGAGGGTTGGCAATGAAG -3'

Sequencing Primer
(F):5'- TCAGGTGCATCATGAAGTCC -3'
(R):5'- TTGGCAATGAAGGAAGACTCCC -3'
Posted On 2018-08-01