Incidental Mutation 'R6753:Prdm9'
ID530930
Institutional Source Beutler Lab
Gene Symbol Prdm9
Ensembl Gene ENSMUSG00000051977
Gene NamePR domain containing 9
SynonymsDsbc1, repro7, Rcr1, Meisetz, G1-419-29
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.368) question?
Stock #R6753 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location15543079-15564354 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 15544956 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 521 (Y521N)
Ref Sequence ENSEMBL: ENSMUSP00000131871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167994]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130297
Predicted Effect probably benign
Transcript: ENSMUST00000167994
AA Change: Y521N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131871
Gene: ENSMUSG00000051977
AA Change: Y521N

DomainStartEndE-ValueType
KRAB 30 89 5.54e-8 SMART
Pfam:SSXRD 175 205 1.5e-20 PFAM
SET 248 368 2.56e-2 SMART
ZnF_C2H2 392 415 3.29e-1 SMART
ZnF_C2H2 516 535 4.74e1 SMART
ZnF_C2H2 541 563 9.73e-4 SMART
ZnF_C2H2 569 591 1.3e-4 SMART
ZnF_C2H2 597 619 1.3e-4 SMART
ZnF_C2H2 625 647 4.24e-4 SMART
ZnF_C2H2 653 675 4.24e-4 SMART
ZnF_C2H2 681 703 1.95e-3 SMART
ZnF_C2H2 709 731 5.99e-4 SMART
ZnF_C2H2 737 759 1.95e-3 SMART
ZnF_C2H2 765 787 1.95e-3 SMART
ZnF_C2H2 793 815 1.3e-4 SMART
ZnF_C2H2 821 843 1.6e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231919
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger protein with histone methyltransferase activity that catalyzes histone H3 lysine 4 trimethylation (H3K4me3) during meiotic prophase. This protein contains multiple domains, including a Kruppel-associated box (KRAB) domain, an SSX repression domain (SSXRD), a PRD1-BF1 and RIZ homologous region, a subclass of SET (PR/SET) domain, and a tandem array of C2H2 zinc fingers. The zinc finger array recognizes a short sequence motif, leading to local H3K4me3, and meiotic recombination hotspot activity. The observed allelic variation alters the DNA-binding sequence specificity of the protein, resulting in distinct meiotic recombination hotspots amongst individuals and populations. Multiple alternate alleles of this gene have been described. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele show decreased oocyte number, azoospermia, and sterility in both sexes due to severe impairment of the double-stranded break repair pathway, deficient pairing of homologous chromosomes, and impaired sex body formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G A 11: 120,010,151 P1083S probably benign Het
Abcb5 T A 12: 118,944,906 N101I possibly damaging Het
Adrb2 A G 18: 62,179,553 V67A possibly damaging Het
Agk T A 6: 40,368,570 probably null Het
Akap10 A T 11: 61,886,777 M586K probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Armc1 A G 3: 19,144,398 F133L possibly damaging Het
Bank1 T C 3: 136,093,308 E424G probably damaging Het
Cacna1a A G 8: 84,580,205 E1363G probably damaging Het
Cacna1d C A 14: 30,042,786 A2076S probably damaging Het
Ccdc73 T A 2: 104,991,524 L606* probably null Het
Ccdc8 C T 7: 16,996,637 Q684* probably null Het
Ces1b T A 8: 93,067,020 K314* probably null Het
Ces1e T A 8: 93,215,128 N238I probably damaging Het
Chd4 A G 6: 125,114,300 N1238S probably benign Het
Cmtr2 T A 8: 110,222,979 D640E probably damaging Het
Col7a1 C T 9: 108,958,128 T559I unknown Het
Comt T C 16: 18,408,021 K205R probably benign Het
Dbp A T 7: 45,708,404 E232V probably damaging Het
Dcbld2 A G 16: 58,456,130 T470A possibly damaging Het
Eml6 T A 11: 29,754,987 D1519V probably damaging Het
Evpl T A 11: 116,237,906 H31L possibly damaging Het
Exoc1 T A 5: 76,563,339 I86N probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fgfr3 T C 5: 33,732,159 S301P probably benign Het
Gas2l1 C T 11: 5,064,254 V69I probably damaging Het
Gm2042 T A 12: 87,958,084 I107K probably damaging Het
Gucy1b1 T C 3: 82,039,747 D385G probably null Het
Ints1 T A 5: 139,765,175 E824D probably damaging Het
Itfg1 T C 8: 85,835,078 D142G probably benign Het
Jaml A G 9: 45,107,379 N359D probably benign Het
Kcnh7 T A 2: 62,850,377 I289L probably benign Het
Klf12 G A 14: 100,109,776 Q40* probably null Het
Mcm4 A C 16: 15,629,362 N579K possibly damaging Het
Mfsd2b A T 12: 4,867,358 F179I possibly damaging Het
Mmp11 C T 10: 75,928,374 V86M probably damaging Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Narf T A 11: 121,242,626 H84Q probably benign Het
Olfr987 C A 2: 85,331,798 M33I probably benign Het
Otog A C 7: 46,249,071 E204D probably benign Het
Parp8 G A 13: 116,895,115 H354Y possibly damaging Het
Pcnx C A 12: 81,964,480 D1238E probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pkd1l3 C T 8: 109,624,449 T642I probably damaging Het
Pkhd1l1 G A 15: 44,589,663 E3995K probably benign Het
Prex2 A G 1: 11,184,456 S1105G probably damaging Het
Prss35 T A 9: 86,756,100 F308I probably damaging Het
Rab22a C T 2: 173,701,055 A167V probably benign Het
Rims2 A G 15: 39,566,973 Q871R possibly damaging Het
Rorb A T 19: 18,957,247 M253K probably benign Het
Ryr3 T C 2: 112,652,610 D4269G probably damaging Het
Snx11 T C 11: 96,769,906 probably benign Het
Son A G 16: 91,657,188 Q941R probably damaging Het
Sptbn2 G T 19: 4,747,785 R1880L probably benign Het
Sun1 G A 5: 139,215,259 probably null Het
Tprn A G 2: 25,264,038 R451G probably benign Het
Trbv30 T A 6: 41,281,377 M1K probably null Het
Ttn C A 2: 76,738,221 G25697W probably damaging Het
Ubb T G 11: 62,551,527 probably null Het
Unc13b C T 4: 43,239,331 R1038C probably damaging Het
Usp7 T C 16: 8,696,911 M687V probably benign Het
Zfp160 G A 17: 21,020,734 M21I probably benign Het
Zfp868 T C 8: 69,612,096 N196S probably benign Het
Zufsp A T 10: 33,928,029 I483N probably damaging Het
Other mutations in Prdm9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Prdm9 APN 17 15553346 missense probably benign 0.11
IGL02322:Prdm9 APN 17 15562848 missense probably damaging 0.99
IGL02354:Prdm9 APN 17 15562847 missense probably damaging 1.00
IGL02361:Prdm9 APN 17 15562847 missense probably damaging 1.00
IGL02724:Prdm9 APN 17 15563260 missense probably benign 0.07
IGL03120:Prdm9 APN 17 15544931 missense probably benign
berlin UTSW 17 15562440 missense probably damaging 0.96
R0173:Prdm9 UTSW 17 15544013 missense probably benign 0.02
R0173:Prdm9 UTSW 17 15544035 missense probably benign 0.00
R0309:Prdm9 UTSW 17 15557384 missense probably damaging 0.98
R1420:Prdm9 UTSW 17 15544376 missense probably damaging 1.00
R3498:Prdm9 UTSW 17 15562945 splice site probably benign
R3714:Prdm9 UTSW 17 15557361 nonsense probably null
R4118:Prdm9 UTSW 17 15544013 missense probably benign 0.02
R4369:Prdm9 UTSW 17 15544446 missense probably benign 0.14
R4691:Prdm9 UTSW 17 15553378 missense probably benign 0.03
R4742:Prdm9 UTSW 17 15553521 missense probably damaging 0.99
R4910:Prdm9 UTSW 17 15544323 missense probably benign 0.08
R5056:Prdm9 UTSW 17 15562417 missense possibly damaging 0.93
R5130:Prdm9 UTSW 17 15544467 missense probably benign 0.00
R5175:Prdm9 UTSW 17 15557451 missense probably benign 0.04
R5187:Prdm9 UTSW 17 15562893 missense probably damaging 0.98
R5213:Prdm9 UTSW 17 15555154 missense probably damaging 0.98
R5270:Prdm9 UTSW 17 15553363 missense probably benign 0.16
R5635:Prdm9 UTSW 17 15562440 missense probably damaging 0.96
R6857:Prdm9 UTSW 17 15544256 missense probably benign 0.04
R7041:Prdm9 UTSW 17 15544995 missense possibly damaging 0.56
R7355:Prdm9 UTSW 17 15545235 missense probably benign 0.01
R7410:Prdm9 UTSW 17 15544997 missense possibly damaging 0.73
R7570:Prdm9 UTSW 17 15555652 missense probably benign 0.14
R7571:Prdm9 UTSW 17 15563264 missense probably damaging 0.98
R7575:Prdm9 UTSW 17 15544628 missense probably damaging 1.00
R7593:Prdm9 UTSW 17 15544605 missense possibly damaging 0.81
R7664:Prdm9 UTSW 17 15555571 missense probably damaging 0.99
X0021:Prdm9 UTSW 17 15553472 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCTGCAAACATAGGGCTTC -3'
(R):5'- AGGCAGAGGATTTCAACAACC -3'

Sequencing Primer
(F):5'- AGGTCTGACTTCTGTGTAAAGCCC -3'
(R):5'- GGCAGAGGATTTCAACAACCTTTCC -3'
Posted On2018-08-01