Incidental Mutation 'R6753:Zfp160'
ID 530931
Institutional Source Beutler Lab
Gene Symbol Zfp160
Ensembl Gene ENSMUSG00000067942
Gene Name zinc finger protein 160
Synonyms 6720480D16Rik, 6720480D16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6753 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 21008903-21043070 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 21020734 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 21 (M21I)
Ref Sequence ENSEMBL: ENSMUSP00000155916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088811] [ENSMUST00000231482] [ENSMUST00000232320] [ENSMUST00000232354] [ENSMUST00000232473] [ENSMUST00000232595] [ENSMUST00000232663]
AlphaFold E9Q459
Predicted Effect probably benign
Transcript: ENSMUST00000088811
AA Change: M57I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000086191
Gene: ENSMUSG00000067942
AA Change: M57I

DomainStartEndE-ValueType
KRAB 8 68 1.91e-29 SMART
low complexity region 100 110 N/A INTRINSIC
ZnF_C2H2 146 168 1.69e-3 SMART
ZnF_C2H2 174 196 2.91e-2 SMART
ZnF_C2H2 202 224 1.4e-4 SMART
ZnF_C2H2 230 252 3.89e-3 SMART
ZnF_C2H2 258 280 1.72e-4 SMART
ZnF_C2H2 286 308 4.94e-5 SMART
ZnF_C2H2 314 336 2.12e-4 SMART
ZnF_C2H2 342 364 1.12e-3 SMART
ZnF_C2H2 370 392 1.2e-3 SMART
ZnF_C2H2 398 420 6.42e-4 SMART
ZnF_C2H2 426 448 9.08e-4 SMART
ZnF_C2H2 454 476 1.84e-4 SMART
ZnF_C2H2 482 504 1.5e-4 SMART
ZnF_C2H2 510 532 3.44e-4 SMART
ZnF_C2H2 538 560 1.12e-3 SMART
ZnF_C2H2 566 588 2.27e-4 SMART
ZnF_C2H2 594 616 1.04e-3 SMART
ZnF_C2H2 622 644 1.13e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231482
AA Change: M21I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000232320
AA Change: M57I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000232354
AA Change: M57I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000232473
AA Change: M21I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000232595
AA Change: M57I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000232663
AA Change: M57I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G A 11: 120,010,151 P1083S probably benign Het
Abcb5 T A 12: 118,944,906 N101I possibly damaging Het
Adrb2 A G 18: 62,179,553 V67A possibly damaging Het
Agk T A 6: 40,368,570 probably null Het
Akap10 A T 11: 61,886,777 M586K probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Armc1 A G 3: 19,144,398 F133L possibly damaging Het
Bank1 T C 3: 136,093,308 E424G probably damaging Het
Cacna1a A G 8: 84,580,205 E1363G probably damaging Het
Cacna1d C A 14: 30,042,786 A2076S probably damaging Het
Ccdc73 T A 2: 104,991,524 L606* probably null Het
Ccdc8 C T 7: 16,996,637 Q684* probably null Het
Ces1b T A 8: 93,067,020 K314* probably null Het
Ces1e T A 8: 93,215,128 N238I probably damaging Het
Chd4 A G 6: 125,114,300 N1238S probably benign Het
Cmtr2 T A 8: 110,222,979 D640E probably damaging Het
Col7a1 C T 9: 108,958,128 T559I unknown Het
Comt T C 16: 18,408,021 K205R probably benign Het
Dbp A T 7: 45,708,404 E232V probably damaging Het
Dcbld2 A G 16: 58,456,130 T470A possibly damaging Het
Eml6 T A 11: 29,754,987 D1519V probably damaging Het
Evpl T A 11: 116,237,906 H31L possibly damaging Het
Exoc1 T A 5: 76,563,339 I86N probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fgfr3 T C 5: 33,732,159 S301P probably benign Het
Gas2l1 C T 11: 5,064,254 V69I probably damaging Het
Gm2042 T A 12: 87,958,084 I107K probably damaging Het
Gucy1b1 T C 3: 82,039,747 D385G probably null Het
Ints1 T A 5: 139,765,175 E824D probably damaging Het
Itfg1 T C 8: 85,835,078 D142G probably benign Het
Jaml A G 9: 45,107,379 N359D probably benign Het
Kcnh7 T A 2: 62,850,377 I289L probably benign Het
Klf12 G A 14: 100,109,776 Q40* probably null Het
Mcm4 A C 16: 15,629,362 N579K possibly damaging Het
Mfsd2b A T 12: 4,867,358 F179I possibly damaging Het
Mmp11 C T 10: 75,928,374 V86M probably damaging Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Narf T A 11: 121,242,626 H84Q probably benign Het
Olfr987 C A 2: 85,331,798 M33I probably benign Het
Otog A C 7: 46,249,071 E204D probably benign Het
Parp8 G A 13: 116,895,115 H354Y possibly damaging Het
Pcnx C A 12: 81,964,480 D1238E probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pkd1l3 C T 8: 109,624,449 T642I probably damaging Het
Pkhd1l1 G A 15: 44,589,663 E3995K probably benign Het
Prdm9 A T 17: 15,544,956 Y521N probably benign Het
Prex2 A G 1: 11,184,456 S1105G probably damaging Het
Prss35 T A 9: 86,756,100 F308I probably damaging Het
Rab22a C T 2: 173,701,055 A167V probably benign Het
Rims2 A G 15: 39,566,973 Q871R possibly damaging Het
Rorb A T 19: 18,957,247 M253K probably benign Het
Ryr3 T C 2: 112,652,610 D4269G probably damaging Het
Snx11 T C 11: 96,769,906 probably benign Het
Son A G 16: 91,657,188 Q941R probably damaging Het
Sptbn2 G T 19: 4,747,785 R1880L probably benign Het
Sun1 G A 5: 139,215,259 probably null Het
Tprn A G 2: 25,264,038 R451G probably benign Het
Trbv30 T A 6: 41,281,377 M1K probably null Het
Ttn C A 2: 76,738,221 G25697W probably damaging Het
Ubb T G 11: 62,551,527 probably null Het
Unc13b C T 4: 43,239,331 R1038C probably damaging Het
Usp7 T C 16: 8,696,911 M687V probably benign Het
Zfp868 T C 8: 69,612,096 N196S probably benign Het
Zufsp A T 10: 33,928,029 I483N probably damaging Het
Other mutations in Zfp160
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Zfp160 APN 17 21026702 missense probably benign
IGL01019:Zfp160 APN 17 21020826 missense possibly damaging 0.68
IGL02430:Zfp160 APN 17 21025530 missense possibly damaging 0.76
R0412:Zfp160 UTSW 17 21026877 missense probably damaging 0.97
R0600:Zfp160 UTSW 17 21027006 missense probably benign 0.00
R2146:Zfp160 UTSW 17 21026982 missense probably benign 0.13
R2157:Zfp160 UTSW 17 21020828 missense probably benign 0.23
R2411:Zfp160 UTSW 17 21025745 missense possibly damaging 0.94
R2904:Zfp160 UTSW 17 21025649 missense probably benign 0.00
R4249:Zfp160 UTSW 17 21025738 missense probably benign 0.11
R4896:Zfp160 UTSW 17 21020081 missense probably benign 0.00
R5106:Zfp160 UTSW 17 21026761 missense probably damaging 0.99
R5342:Zfp160 UTSW 17 21020733 missense possibly damaging 0.95
R5352:Zfp160 UTSW 17 21026852 missense probably benign 0.02
R6193:Zfp160 UTSW 17 21026862 missense probably benign 0.24
R6230:Zfp160 UTSW 17 21026445 missense probably benign 0.38
R6928:Zfp160 UTSW 17 21041462 missense probably benign 0.04
R7040:Zfp160 UTSW 17 21026532 missense probably damaging 1.00
R7255:Zfp160 UTSW 17 21025487 missense probably benign 0.18
R7497:Zfp160 UTSW 17 21026193 missense probably benign 0.08
R7510:Zfp160 UTSW 17 21026393 missense probably benign 0.00
R7540:Zfp160 UTSW 17 21025660 nonsense probably null
R7627:Zfp160 UTSW 17 21027008 missense probably damaging 0.99
R8169:Zfp160 UTSW 17 21027036 missense probably damaging 0.97
R8240:Zfp160 UTSW 17 21026088 missense probably damaging 0.99
R8330:Zfp160 UTSW 17 21026051 missense probably damaging 1.00
R8367:Zfp160 UTSW 17 21025542 missense probably benign 0.22
R8802:Zfp160 UTSW 17 21026605 missense probably damaging 1.00
R9183:Zfp160 UTSW 17 21020092 missense possibly damaging 0.84
Z1177:Zfp160 UTSW 17 21026890 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGAAGGAGGCATTCAGTG -3'
(R):5'- ATTACCTGGCACCACATGAG -3'

Sequencing Primer
(F):5'- AAGGAGGCATTCAGTGATGATTTTG -3'
(R):5'- AGTGGCAGACTTATTTCTCACTGAGC -3'
Posted On 2018-08-01