Incidental Mutation 'R6753:Sptbn2'
ID 530933
Institutional Source Beutler Lab
Gene Symbol Sptbn2
Ensembl Gene ENSMUSG00000067889
Gene Name spectrin beta, non-erythrocytic 2
Synonyms Spnb3
MMRRC Submission 044870-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6753 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 4711208-4752353 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 4747785 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 1880 (R1880L)
Ref Sequence ENSEMBL: ENSMUSP00000008991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008991] [ENSMUST00000178353]
AlphaFold Q68FG2
Predicted Effect probably benign
Transcript: ENSMUST00000008991
AA Change: R1880L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000008991
Gene: ENSMUSG00000067889
AA Change: R1880L

DomainStartEndE-ValueType
CH 59 159 1.86e-28 SMART
CH 178 276 2.86e-20 SMART
SPEC 308 414 4.63e-1 SMART
SPEC 428 528 3.07e-23 SMART
SPEC 534 638 4.47e-25 SMART
SPEC 644 744 1.28e-25 SMART
SPEC 750 849 4.98e-23 SMART
SPEC 855 955 1.63e-18 SMART
SPEC 961 1062 1.45e-24 SMART
SPEC 1068 1169 4.15e-20 SMART
SPEC 1175 1275 5.26e-22 SMART
SPEC 1281 1380 1.17e-19 SMART
SPEC 1386 1485 2.06e-24 SMART
SPEC 1491 1585 1.74e-22 SMART
SPEC 1591 1691 5.42e-24 SMART
SPEC 1697 1798 2.1e-21 SMART
SPEC 1804 1904 5.47e-20 SMART
SPEC 1910 2010 1.99e-22 SMART
SPEC 2016 2256 2.92e-6 SMART
PH 2219 2330 1.65e-14 SMART
low complexity region 2373 2386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178353
SMART Domains Protein: ENSMUSP00000136599
Gene: ENSMUSG00000096370

DomainStartEndE-ValueType
RRM 2 69 1.96e-17 SMART
Pfam:RRM_1 81 118 5.6e-7 PFAM
Meta Mutation Damage Score 0.1506 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are principle components of a cell's membrane-cytoskeleton and are composed of two alpha and two beta spectrin subunits. The protein encoded by this gene (SPTBN2), is called spectrin beta non-erythrocytic 2 or beta-III spectrin. It is related to, but distinct from, the beta-II spectrin gene which is also known as spectrin beta non-erythrocytic 1 (SPTBN1). SPTBN2 regulates the glutamate signaling pathway by stabilizing the glutamate transporter EAAT4 at the surface of the plasma membrane. Mutations in this gene cause a form of spinocerebellar ataxia, SCA5, that is characterized by neurodegeneration, progressive locomotor incoordination, dysarthria, and uncoordinated eye movements. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous hypomorphic mutants exhibit a progressive ataxic phenotype with gait abnormalities, tremor, deteriorating motor coordination, Purkinje cell loss, and cerebellar atrophy (molecular layer thinning) and age-related reduction in simple firing ratein surviving Purkinje cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G A 11: 120,010,151 P1083S probably benign Het
Abcb5 T A 12: 118,944,906 N101I possibly damaging Het
Adrb2 A G 18: 62,179,553 V67A possibly damaging Het
Agk T A 6: 40,368,570 probably null Het
Akap10 A T 11: 61,886,777 M586K probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Armc1 A G 3: 19,144,398 F133L possibly damaging Het
Bank1 T C 3: 136,093,308 E424G probably damaging Het
Cacna1a A G 8: 84,580,205 E1363G probably damaging Het
Cacna1d C A 14: 30,042,786 A2076S probably damaging Het
Ccdc73 T A 2: 104,991,524 L606* probably null Het
Ccdc8 C T 7: 16,996,637 Q684* probably null Het
Ces1b T A 8: 93,067,020 K314* probably null Het
Ces1e T A 8: 93,215,128 N238I probably damaging Het
Chd4 A G 6: 125,114,300 N1238S probably benign Het
Cmtr2 T A 8: 110,222,979 D640E probably damaging Het
Col7a1 C T 9: 108,958,128 T559I unknown Het
Comt T C 16: 18,408,021 K205R probably benign Het
Dbp A T 7: 45,708,404 E232V probably damaging Het
Dcbld2 A G 16: 58,456,130 T470A possibly damaging Het
Eml6 T A 11: 29,754,987 D1519V probably damaging Het
Evpl T A 11: 116,237,906 H31L possibly damaging Het
Exoc1 T A 5: 76,563,339 I86N probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fgfr3 T C 5: 33,732,159 S301P probably benign Het
Gas2l1 C T 11: 5,064,254 V69I probably damaging Het
Gm2042 T A 12: 87,958,084 I107K probably damaging Het
Gucy1b1 T C 3: 82,039,747 D385G probably null Het
Ints1 T A 5: 139,765,175 E824D probably damaging Het
Itfg1 T C 8: 85,835,078 D142G probably benign Het
Jaml A G 9: 45,107,379 N359D probably benign Het
Kcnh7 T A 2: 62,850,377 I289L probably benign Het
Klf12 G A 14: 100,109,776 Q40* probably null Het
Mcm4 A C 16: 15,629,362 N579K possibly damaging Het
Mfsd2b A T 12: 4,867,358 F179I possibly damaging Het
Mmp11 C T 10: 75,928,374 V86M probably damaging Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Narf T A 11: 121,242,626 H84Q probably benign Het
Olfr987 C A 2: 85,331,798 M33I probably benign Het
Otog A C 7: 46,249,071 E204D probably benign Het
Parp8 G A 13: 116,895,115 H354Y possibly damaging Het
Pcnx C A 12: 81,964,480 D1238E probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pkd1l3 C T 8: 109,624,449 T642I probably damaging Het
Pkhd1l1 G A 15: 44,589,663 E3995K probably benign Het
Prdm9 A T 17: 15,544,956 Y521N probably benign Het
Prex2 A G 1: 11,184,456 S1105G probably damaging Het
Prss35 T A 9: 86,756,100 F308I probably damaging Het
Rab22a C T 2: 173,701,055 A167V probably benign Het
Rims2 A G 15: 39,566,973 Q871R possibly damaging Het
Rorb A T 19: 18,957,247 M253K probably benign Het
Ryr3 T C 2: 112,652,610 D4269G probably damaging Het
Snx11 T C 11: 96,769,906 probably benign Het
Son A G 16: 91,657,188 Q941R probably damaging Het
Sun1 G A 5: 139,215,259 probably null Het
Tprn A G 2: 25,264,038 R451G probably benign Het
Trbv30 T A 6: 41,281,377 M1K probably null Het
Ttn C A 2: 76,738,221 G25697W probably damaging Het
Ubb T G 11: 62,551,527 probably null Het
Unc13b C T 4: 43,239,331 R1038C probably damaging Het
Usp7 T C 16: 8,696,911 M687V probably benign Het
Zfp160 G A 17: 21,020,734 M21I probably benign Het
Zfp868 T C 8: 69,612,096 N196S probably benign Het
Zufsp A T 10: 33,928,029 I483N probably damaging Het
Other mutations in Sptbn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Sptbn2 APN 19 4724705 missense possibly damaging 0.94
IGL00688:Sptbn2 APN 19 4725938 missense probably damaging 1.00
IGL01339:Sptbn2 APN 19 4745972 nonsense probably null
IGL01373:Sptbn2 APN 19 4745972 nonsense probably null
IGL01420:Sptbn2 APN 19 4734125 missense probably benign
IGL01456:Sptbn2 APN 19 4746749 missense probably damaging 1.00
IGL01953:Sptbn2 APN 19 4749693 missense probably benign
IGL03026:Sptbn2 APN 19 4724233 critical splice donor site probably null
IGL03275:Sptbn2 APN 19 4732661 missense possibly damaging 0.65
IGL03286:Sptbn2 APN 19 4747832 missense probably damaging 0.97
F5770:Sptbn2 UTSW 19 4750632 missense probably damaging 1.00
PIT4696001:Sptbn2 UTSW 19 4745577 missense probably benign 0.00
R0046:Sptbn2 UTSW 19 4745377 intron probably benign
R0046:Sptbn2 UTSW 19 4745377 intron probably benign
R0121:Sptbn2 UTSW 19 4745293 missense probably damaging 1.00
R0127:Sptbn2 UTSW 19 4724744 missense probably damaging 1.00
R0212:Sptbn2 UTSW 19 4746942 critical splice donor site probably null
R0277:Sptbn2 UTSW 19 4745145 missense probably benign 0.28
R0417:Sptbn2 UTSW 19 4737926 missense probably benign 0.01
R0457:Sptbn2 UTSW 19 4745938 missense possibly damaging 0.89
R0536:Sptbn2 UTSW 19 4726690 missense probably damaging 0.99
R0631:Sptbn2 UTSW 19 4739986 missense probably benign 0.01
R0734:Sptbn2 UTSW 19 4748123 nonsense probably null
R0742:Sptbn2 UTSW 19 4718983 missense possibly damaging 0.46
R1195:Sptbn2 UTSW 19 4745893 missense possibly damaging 0.85
R1195:Sptbn2 UTSW 19 4745893 missense possibly damaging 0.85
R1195:Sptbn2 UTSW 19 4745893 missense possibly damaging 0.85
R1364:Sptbn2 UTSW 19 4732665 missense probably damaging 1.00
R1495:Sptbn2 UTSW 19 4718976 missense possibly damaging 0.92
R1498:Sptbn2 UTSW 19 4744246 missense possibly damaging 0.94
R1606:Sptbn2 UTSW 19 4750242 critical splice donor site probably null
R1678:Sptbn2 UTSW 19 4750497 missense probably damaging 1.00
R1746:Sptbn2 UTSW 19 4745964 nonsense probably null
R1820:Sptbn2 UTSW 19 4726596 missense probably damaging 0.98
R1830:Sptbn2 UTSW 19 4732541 missense probably benign 0.09
R1863:Sptbn2 UTSW 19 4732685 missense possibly damaging 0.54
R1967:Sptbn2 UTSW 19 4745299 missense probably benign 0.00
R2085:Sptbn2 UTSW 19 4738559 missense probably benign 0.09
R2301:Sptbn2 UTSW 19 4734138 missense probably benign 0.00
R2310:Sptbn2 UTSW 19 4718935 missense probably benign 0.19
R2888:Sptbn2 UTSW 19 4748636 missense possibly damaging 0.52
R3788:Sptbn2 UTSW 19 4745922 missense probably damaging 1.00
R4429:Sptbn2 UTSW 19 4738355 missense probably damaging 1.00
R4536:Sptbn2 UTSW 19 4732602 missense probably damaging 1.00
R4662:Sptbn2 UTSW 19 4739239 missense probably damaging 1.00
R4672:Sptbn2 UTSW 19 4732496 missense probably benign 0.25
R4731:Sptbn2 UTSW 19 4742480 missense probably damaging 0.96
R4747:Sptbn2 UTSW 19 4748154 missense probably benign 0.27
R4889:Sptbn2 UTSW 19 4729430 missense possibly damaging 0.69
R4891:Sptbn2 UTSW 19 4738469 missense probably damaging 1.00
R4965:Sptbn2 UTSW 19 4729309 missense probably benign 0.13
R4968:Sptbn2 UTSW 19 4729202 splice site probably null
R4981:Sptbn2 UTSW 19 4751658 missense probably benign 0.22
R5159:Sptbn2 UTSW 19 4737857 missense probably benign 0.12
R5202:Sptbn2 UTSW 19 4724184 missense probably damaging 1.00
R5253:Sptbn2 UTSW 19 4750082 missense probably benign 0.01
R5294:Sptbn2 UTSW 19 4718908 missense possibly damaging 0.67
R5465:Sptbn2 UTSW 19 4750105 missense probably benign 0.00
R5546:Sptbn2 UTSW 19 4725950 missense probably damaging 1.00
R5593:Sptbn2 UTSW 19 4748947 missense probably damaging 1.00
R5780:Sptbn2 UTSW 19 4724667 missense probably damaging 1.00
R5835:Sptbn2 UTSW 19 4738219 missense probably damaging 1.00
R6008:Sptbn2 UTSW 19 4739278 missense possibly damaging 0.89
R6108:Sptbn2 UTSW 19 4731392 critical splice donor site probably null
R6236:Sptbn2 UTSW 19 4748138 missense probably benign 0.01
R6307:Sptbn2 UTSW 19 4724646 missense probably damaging 1.00
R6383:Sptbn2 UTSW 19 4732496 missense possibly damaging 0.89
R6397:Sptbn2 UTSW 19 4742418 missense possibly damaging 0.91
R6453:Sptbn2 UTSW 19 4744180 missense possibly damaging 0.67
R6561:Sptbn2 UTSW 19 4747926 missense probably benign 0.39
R6564:Sptbn2 UTSW 19 4732024 missense probably damaging 1.00
R6644:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R6703:Sptbn2 UTSW 19 4749814 missense probably benign
R6703:Sptbn2 UTSW 19 4749815 missense probably benign
R7007:Sptbn2 UTSW 19 4744145 missense possibly damaging 0.82
R7131:Sptbn2 UTSW 19 4749460 missense probably null
R7219:Sptbn2 UTSW 19 4724173 missense probably damaging 1.00
R7285:Sptbn2 UTSW 19 4737443 missense probably benign 0.00
R7308:Sptbn2 UTSW 19 4751574 missense probably benign
R7469:Sptbn2 UTSW 19 4745118 missense probably benign 0.00
R7502:Sptbn2 UTSW 19 4748082 missense probably benign 0.02
R7623:Sptbn2 UTSW 19 4726168 missense probably damaging 1.00
R7635:Sptbn2 UTSW 19 4744207 missense probably damaging 1.00
R7733:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7738:Sptbn2 UTSW 19 4724125 missense probably damaging 1.00
R7742:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7767:Sptbn2 UTSW 19 4734143 missense possibly damaging 0.62
R7795:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7796:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7871:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7877:Sptbn2 UTSW 19 4744262 missense possibly damaging 0.93
R7920:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7921:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7923:Sptbn2 UTSW 19 4746799 missense probably benign 0.01
R8137:Sptbn2 UTSW 19 4737403 missense possibly damaging 0.81
R8305:Sptbn2 UTSW 19 4729130 missense possibly damaging 0.81
R8695:Sptbn2 UTSW 19 4746696 missense possibly damaging 0.86
R8790:Sptbn2 UTSW 19 4732024 missense probably damaging 1.00
R9125:Sptbn2 UTSW 19 4734213 missense probably benign 0.04
R9483:Sptbn2 UTSW 19 4739946 missense probably damaging 1.00
R9620:Sptbn2 UTSW 19 4750507 missense probably damaging 0.99
R9631:Sptbn2 UTSW 19 4738190 missense probably damaging 1.00
R9646:Sptbn2 UTSW 19 4745313 missense probably damaging 1.00
R9694:Sptbn2 UTSW 19 4750507 missense probably damaging 0.99
V7580:Sptbn2 UTSW 19 4750632 missense probably damaging 1.00
Z1176:Sptbn2 UTSW 19 4738205 missense probably damaging 1.00
Z1176:Sptbn2 UTSW 19 4745191 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAACTTTGGCTGGTGGAACAG -3'
(R):5'- GCATCATACAACTTGTGAAGGAC -3'

Sequencing Primer
(F):5'- CAGACATGAAGTAGAAAGCCATGTG -3'
(R):5'- ACACCAGGCACTATGGGTCTC -3'
Posted On 2018-08-01