Mutagenetix > Incidental Mutations

Incidental Mutation 'R6753:Sptbn2'

530933

Institutional Source

Beutler Lab

Gene Symbol

Sptbn2

Ensembl Gene

ENSMUSG00000067889

Gene Name

spectrin beta, non-erythrocytic 2

Synonyms

Spnb3

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6753 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4711208-4752353 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 4747785 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 1880 (R1880L)

Ref Sequence

ENSEMBL: ENSMUSP00000008991 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000008991] [ENSMUST00000178353]

AlphaFold

Q68FG2

Predicted Effect

probably benign
Transcript: ENSMUST00000008991
AA Change: R1880L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000008991
Gene: ENSMUSG00000067889
AA Change: R1880L

Domain	Start	End	E-Value	Type
CH	59	159	1.86e-28	SMART
CH	178	276	2.86e-20	SMART
SPEC	308	414	4.63e-1	SMART
SPEC	428	528	3.07e-23	SMART
SPEC	534	638	4.47e-25	SMART
SPEC	644	744	1.28e-25	SMART
SPEC	750	849	4.98e-23	SMART
SPEC	855	955	1.63e-18	SMART
SPEC	961	1062	1.45e-24	SMART
SPEC	1068	1169	4.15e-20	SMART
SPEC	1175	1275	5.26e-22	SMART
SPEC	1281	1380	1.17e-19	SMART
SPEC	1386	1485	2.06e-24	SMART
SPEC	1491	1585	1.74e-22	SMART
SPEC	1591	1691	5.42e-24	SMART
SPEC	1697	1798	2.1e-21	SMART
SPEC	1804	1904	5.47e-20	SMART
SPEC	1910	2010	1.99e-22	SMART
SPEC	2016	2256	2.92e-6	SMART
PH	2219	2330	1.65e-14	SMART
low complexity region	2373	2386	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000178353

SMART Domains

Protein: ENSMUSP00000136599
Gene: ENSMUSG00000096370

Domain	Start	End	E-Value	Type
RRM	2	69	1.96e-17	SMART
Pfam:RRM_1	81	118	5.6e-7	PFAM

Meta Mutation Damage Score

0.1506

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.1%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are principle components of a cell's membrane-cytoskeleton and are composed of two alpha and two beta spectrin subunits. The protein encoded by this gene (SPTBN2), is called spectrin beta non-erythrocytic 2 or beta-III spectrin. It is related to, but distinct from, the beta-II spectrin gene which is also known as spectrin beta non-erythrocytic 1 (SPTBN1). SPTBN2 regulates the glutamate signaling pathway by stabilizing the glutamate transporter EAAT4 at the surface of the plasma membrane. Mutations in this gene cause a form of spinocerebellar ataxia, SCA5, that is characterized by neurodegeneration, progressive locomotor incoordination, dysarthria, and uncoordinated eye movements. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous hypomorphic mutants exhibit a progressive ataxic phenotype with gait abnormalities, tremor, deteriorating motor coordination, Purkinje cell loss, and cerebellar atrophy (molecular layer thinning) and age-related reduction in simple firing ratein surviving Purkinje cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	G	A	11: 120,010,151	P1083S	probably benign	Het
Abcb5	T	A	12: 118,944,906	N101I	possibly damaging	Het
Adrb2	A	G	18: 62,179,553	V67A	possibly damaging	Het
Agk	T	A	6: 40,368,570		probably null	Het
Akap10	A	T	11: 61,886,777	M586K	probably damaging	Het
Akt3	A	T	1: 177,050,190	Y337*	probably null	Het
Armc1	A	G	3: 19,144,398	F133L	possibly damaging	Het
Bank1	T	C	3: 136,093,308	E424G	probably damaging	Het
Cacna1a	A	G	8: 84,580,205	E1363G	probably damaging	Het
Cacna1d	C	A	14: 30,042,786	A2076S	probably damaging	Het
Ccdc73	T	A	2: 104,991,524	L606*	probably null	Het
Ccdc8	C	T	7: 16,996,637	Q684*	probably null	Het
Ces1b	T	A	8: 93,067,020	K314*	probably null	Het
Ces1e	T	A	8: 93,215,128	N238I	probably damaging	Het
Chd4	A	G	6: 125,114,300	N1238S	probably benign	Het
Cmtr2	T	A	8: 110,222,979	D640E	probably damaging	Het
Col7a1	C	T	9: 108,958,128	T559I	unknown	Het
Comt	T	C	16: 18,408,021	K205R	probably benign	Het
Dbp	A	T	7: 45,708,404	E232V	probably damaging	Het
Dcbld2	A	G	16: 58,456,130	T470A	possibly damaging	Het
Eml6	T	A	11: 29,754,987	D1519V	probably damaging	Het
Evpl	T	A	11: 116,237,906	H31L	possibly damaging	Het
Exoc1	T	A	5: 76,563,339	I86N	probably damaging	Het
Fat3	C	T	9: 15,915,061	E4532K	possibly damaging	Het
Fgfr3	T	C	5: 33,732,159	S301P	probably benign	Het
Gas2l1	C	T	11: 5,064,254	V69I	probably damaging	Het
Gm2042	T	A	12: 87,958,084	I107K	probably damaging	Het
Gucy1b1	T	C	3: 82,039,747	D385G	probably null	Het
Ints1	T	A	5: 139,765,175	E824D	probably damaging	Het
Itfg1	T	C	8: 85,835,078	D142G	probably benign	Het
Jaml	A	G	9: 45,107,379	N359D	probably benign	Het
Kcnh7	T	A	2: 62,850,377	I289L	probably benign	Het
Klf12	G	A	14: 100,109,776	Q40*	probably null	Het
Mcm4	A	C	16: 15,629,362	N579K	possibly damaging	Het
Mfsd2b	A	T	12: 4,867,358	F179I	possibly damaging	Het
Mmp11	C	T	10: 75,928,374	V86M	probably damaging	Het
Mogs	T	C	6: 83,115,882	V101A	probably damaging	Het
Narf	T	A	11: 121,242,626	H84Q	probably benign	Het
Olfr987	C	A	2: 85,331,798	M33I	probably benign	Het
Otog	A	C	7: 46,249,071	E204D	probably benign	Het
Parp8	G	A	13: 116,895,115	H354Y	possibly damaging	Het
Pcnx	C	A	12: 81,964,480	D1238E	probably damaging	Het
Pi4ka	A	G	16: 17,376,982	L184P	possibly damaging	Het
Pkd1l3	C	T	8: 109,624,449	T642I	probably damaging	Het
Pkhd1l1	G	A	15: 44,589,663	E3995K	probably benign	Het
Prdm9	A	T	17: 15,544,956	Y521N	probably benign	Het
Prex2	A	G	1: 11,184,456	S1105G	probably damaging	Het
Prss35	T	A	9: 86,756,100	F308I	probably damaging	Het
Rab22a	C	T	2: 173,701,055	A167V	probably benign	Het
Rims2	A	G	15: 39,566,973	Q871R	possibly damaging	Het
Rorb	A	T	19: 18,957,247	M253K	probably benign	Het
Ryr3	T	C	2: 112,652,610	D4269G	probably damaging	Het
Snx11	T	C	11: 96,769,906		probably benign	Het
Son	A	G	16: 91,657,188	Q941R	probably damaging	Het
Sun1	G	A	5: 139,215,259		probably null	Het
Tprn	A	G	2: 25,264,038	R451G	probably benign	Het
Trbv30	T	A	6: 41,281,377	M1K	probably null	Het
Ttn	C	A	2: 76,738,221	G25697W	probably damaging	Het
Ubb	T	G	11: 62,551,527		probably null	Het
Unc13b	C	T	4: 43,239,331	R1038C	probably damaging	Het
Usp7	T	C	16: 8,696,911	M687V	probably benign	Het
Zfp160	G	A	17: 21,020,734	M21I	probably benign	Het
Zfp868	T	C	8: 69,612,096	N196S	probably benign	Het
Zufsp	A	T	10: 33,928,029	I483N	probably damaging	Het

Other mutations in Sptbn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Sptbn2	APN	19	4724705	missense	possibly damaging	0.94
IGL00688:Sptbn2	APN	19	4725938	missense	probably damaging	1.00
IGL01339:Sptbn2	APN	19	4745972	nonsense	probably null
IGL01373:Sptbn2	APN	19	4745972	nonsense	probably null
IGL01420:Sptbn2	APN	19	4734125	missense	probably benign
IGL01456:Sptbn2	APN	19	4746749	missense	probably damaging	1.00
IGL01953:Sptbn2	APN	19	4749693	missense	probably benign
IGL03026:Sptbn2	APN	19	4724233	critical splice donor site	probably null
IGL03275:Sptbn2	APN	19	4732661	missense	possibly damaging	0.65
IGL03286:Sptbn2	APN	19	4747832	missense	probably damaging	0.97
F5770:Sptbn2	UTSW	19	4750632	missense	probably damaging	1.00
PIT4696001:Sptbn2	UTSW	19	4745577	missense	probably benign	0.00
R0046:Sptbn2	UTSW	19	4745377	intron	probably benign
R0046:Sptbn2	UTSW	19	4745377	intron	probably benign
R0121:Sptbn2	UTSW	19	4745293	missense	probably damaging	1.00
R0127:Sptbn2	UTSW	19	4724744	missense	probably damaging	1.00
R0212:Sptbn2	UTSW	19	4746942	critical splice donor site	probably null
R0277:Sptbn2	UTSW	19	4745145	missense	probably benign	0.28
R0417:Sptbn2	UTSW	19	4737926	missense	probably benign	0.01
R0457:Sptbn2	UTSW	19	4745938	missense	possibly damaging	0.89
R0536:Sptbn2	UTSW	19	4726690	missense	probably damaging	0.99
R0631:Sptbn2	UTSW	19	4739986	missense	probably benign	0.01
R0734:Sptbn2	UTSW	19	4748123	nonsense	probably null
R0742:Sptbn2	UTSW	19	4718983	missense	possibly damaging	0.46
R1195:Sptbn2	UTSW	19	4745893	missense	possibly damaging	0.85
R1195:Sptbn2	UTSW	19	4745893	missense	possibly damaging	0.85
R1195:Sptbn2	UTSW	19	4745893	missense	possibly damaging	0.85
R1364:Sptbn2	UTSW	19	4732665	missense	probably damaging	1.00
R1495:Sptbn2	UTSW	19	4718976	missense	possibly damaging	0.92
R1498:Sptbn2	UTSW	19	4744246	missense	possibly damaging	0.94
R1606:Sptbn2	UTSW	19	4750242	critical splice donor site	probably null
R1678:Sptbn2	UTSW	19	4750497	missense	probably damaging	1.00
R1746:Sptbn2	UTSW	19	4745964	nonsense	probably null
R1820:Sptbn2	UTSW	19	4726596	missense	probably damaging	0.98
R1830:Sptbn2	UTSW	19	4732541	missense	probably benign	0.09
R1863:Sptbn2	UTSW	19	4732685	missense	possibly damaging	0.54
R1967:Sptbn2	UTSW	19	4745299	missense	probably benign	0.00
R2085:Sptbn2	UTSW	19	4738559	missense	probably benign	0.09
R2301:Sptbn2	UTSW	19	4734138	missense	probably benign	0.00
R2310:Sptbn2	UTSW	19	4718935	missense	probably benign	0.19
R2888:Sptbn2	UTSW	19	4748636	missense	possibly damaging	0.52
R3788:Sptbn2	UTSW	19	4745922	missense	probably damaging	1.00
R4429:Sptbn2	UTSW	19	4738355	missense	probably damaging	1.00
R4536:Sptbn2	UTSW	19	4732602	missense	probably damaging	1.00
R4662:Sptbn2	UTSW	19	4739239	missense	probably damaging	1.00
R4672:Sptbn2	UTSW	19	4732496	missense	probably benign	0.25
R4731:Sptbn2	UTSW	19	4742480	missense	probably damaging	0.96
R4747:Sptbn2	UTSW	19	4748154	missense	probably benign	0.27
R4889:Sptbn2	UTSW	19	4729430	missense	possibly damaging	0.69
R4891:Sptbn2	UTSW	19	4738469	missense	probably damaging	1.00
R4965:Sptbn2	UTSW	19	4729309	missense	probably benign	0.13
R4968:Sptbn2	UTSW	19	4729202	splice site	probably null
R4981:Sptbn2	UTSW	19	4751658	missense	probably benign	0.22
R5159:Sptbn2	UTSW	19	4737857	missense	probably benign	0.12
R5202:Sptbn2	UTSW	19	4724184	missense	probably damaging	1.00
R5253:Sptbn2	UTSW	19	4750082	missense	probably benign	0.01
R5294:Sptbn2	UTSW	19	4718908	missense	possibly damaging	0.67
R5465:Sptbn2	UTSW	19	4750105	missense	probably benign	0.00
R5546:Sptbn2	UTSW	19	4725950	missense	probably damaging	1.00
R5593:Sptbn2	UTSW	19	4748947	missense	probably damaging	1.00
R5780:Sptbn2	UTSW	19	4724667	missense	probably damaging	1.00
R5835:Sptbn2	UTSW	19	4738219	missense	probably damaging	1.00
R6008:Sptbn2	UTSW	19	4739278	missense	possibly damaging	0.89
R6108:Sptbn2	UTSW	19	4731392	critical splice donor site	probably null
R6236:Sptbn2	UTSW	19	4748138	missense	probably benign	0.01
R6307:Sptbn2	UTSW	19	4724646	missense	probably damaging	1.00
R6383:Sptbn2	UTSW	19	4732496	missense	possibly damaging	0.89
R6397:Sptbn2	UTSW	19	4742418	missense	possibly damaging	0.91
R6453:Sptbn2	UTSW	19	4744180	missense	possibly damaging	0.67
R6561:Sptbn2	UTSW	19	4747926	missense	probably benign	0.39
R6564:Sptbn2	UTSW	19	4732024	missense	probably damaging	1.00
R6644:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R6703:Sptbn2	UTSW	19	4749814	missense	probably benign
R6703:Sptbn2	UTSW	19	4749815	missense	probably benign
R7007:Sptbn2	UTSW	19	4744145	missense	possibly damaging	0.82
R7131:Sptbn2	UTSW	19	4749460	missense	probably null
R7219:Sptbn2	UTSW	19	4724173	missense	probably damaging	1.00
R7285:Sptbn2	UTSW	19	4737443	missense	probably benign	0.00
R7308:Sptbn2	UTSW	19	4751574	missense	probably benign
R7469:Sptbn2	UTSW	19	4745118	missense	probably benign	0.00
R7502:Sptbn2	UTSW	19	4748082	missense	probably benign	0.02
R7623:Sptbn2	UTSW	19	4726168	missense	probably damaging	1.00
R7635:Sptbn2	UTSW	19	4744207	missense	probably damaging	1.00
R7733:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7738:Sptbn2	UTSW	19	4724125	missense	probably damaging	1.00
R7742:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7767:Sptbn2	UTSW	19	4734143	missense	possibly damaging	0.62
R7795:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7796:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7871:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7877:Sptbn2	UTSW	19	4744262	missense	possibly damaging	0.93
R7920:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7921:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7923:Sptbn2	UTSW	19	4746799	missense	probably benign	0.01
R8137:Sptbn2	UTSW	19	4737403	missense	possibly damaging	0.81
R8305:Sptbn2	UTSW	19	4729130	missense	possibly damaging	0.81
R8695:Sptbn2	UTSW	19	4746696	missense	possibly damaging	0.86
R8790:Sptbn2	UTSW	19	4732024	missense	probably damaging	1.00
R9125:Sptbn2	UTSW	19	4734213	missense	probably benign	0.04
V7580:Sptbn2	UTSW	19	4750632	missense	probably damaging	1.00
Z1176:Sptbn2	UTSW	19	4738205	missense	probably damaging	1.00
Z1176:Sptbn2	UTSW	19	4745191	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CAACTTTGGCTGGTGGAACAG -3'
(R):5'- GCATCATACAACTTGTGAAGGAC -3'

Sequencing Primer
(F):5'- CAGACATGAAGTAGAAAGCCATGTG -3'
(R):5'- ACACCAGGCACTATGGGTCTC -3'

Posted On

2018-08-01