Incidental Mutation 'R6754:Olfr1221'
ID530941
Institutional Source Beutler Lab
Gene Symbol Olfr1221
Ensembl Gene ENSMUSG00000075102
Gene Nameolfactory receptor 1221
SynonymsGA_x6K02T2Q125-50591144-50590209, MOR233-3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6754 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location89109086-89117283 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 89112296 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 72 (T72N)
Ref Sequence ENSEMBL: ENSMUSP00000149330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099795] [ENSMUST00000143255] [ENSMUST00000213404] [ENSMUST00000217635]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099795
AA Change: T72N

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097383
Gene: ENSMUSG00000075102
AA Change: T72N

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 5.6e-48 PFAM
Pfam:7tm_1 39 302 3.6e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000143255
AA Change: T72N

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213404
AA Change: T72N

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217635
AA Change: T72N

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T C 17: 56,883,358 F352L probably damaging Het
Acta2 T C 19: 34,244,983 D246G probably damaging Het
Ank2 A G 3: 127,096,839 probably benign Het
Bmpr2 T A 1: 59,870,280 I971N probably damaging Het
C9 C A 15: 6,489,943 C8* probably null Het
Casp2 T A 6: 42,269,330 N207K probably damaging Het
Cd302 T G 2: 60,272,107 D56A probably benign Het
Cecr2 C T 6: 120,757,578 P605S probably damaging Het
Cep152 A G 2: 125,587,668 V723A probably damaging Het
Col17a1 C T 19: 47,650,721 probably null Het
Ctsk T C 3: 95,502,685 V168A probably damaging Het
Cyp2c54 A T 19: 40,071,560 N176K probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
F5 A G 1: 164,193,763 D1269G probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Hivep2 G A 10: 14,129,638 G660D probably benign Het
Hspb3 A T 13: 113,663,152 I114K probably damaging Het
Itgb7 T G 15: 102,216,160 *807C probably null Het
Kbtbd2 A G 6: 56,779,254 V499A probably damaging Het
Lemd3 A T 10: 120,933,660 I589N probably damaging Het
Mettl13 T C 1: 162,548,123 Y45C probably damaging Het
Mllt6 C T 11: 97,674,447 T571I probably damaging Het
Mrvi1 G A 7: 110,929,512 P43S probably damaging Het
Nabp1 A G 1: 51,474,540 I99T probably damaging Het
Ndufa4 A G 6: 11,906,053 V33A probably benign Het
Nr1h5 A G 3: 102,949,597 S200P probably damaging Het
Ntsr1 G A 2: 180,542,683 R393H probably benign Het
Olfr115 T C 17: 37,610,155 N199D probably benign Het
Pcdhb21 A T 18: 37,514,683 K288N probably benign Het
Pla2g6 T C 15: 79,306,310 N351D probably benign Het
Polg T C 7: 79,459,836 E411G probably damaging Het
Ppp1r32 A T 19: 10,477,089 Y328N probably damaging Het
Prdm11 A G 2: 93,013,792 L31P probably damaging Het
Rab27b G A 18: 69,996,103 T40I probably damaging Het
Rnf219 C T 14: 104,503,414 E191K probably damaging Het
Ruvbl2 T C 7: 45,428,758 D97G probably benign Het
Sema3a T C 5: 13,599,275 V664A possibly damaging Het
Sh2d3c T C 2: 32,754,530 S842P probably damaging Het
Spam1 A G 6: 24,796,316 T89A probably damaging Het
Stab1 C T 14: 31,141,081 G2187E probably benign Het
Tff2 C A 17: 31,144,233 A6S probably benign Het
Trim80 T C 11: 115,448,174 V610A probably damaging Het
Trp53bp1 A G 2: 121,270,576 V47A possibly damaging Het
Ufl1 G A 4: 25,267,796 Q292* probably null Het
Ulk1 A T 5: 110,790,393 V571E possibly damaging Het
Usp24 A T 4: 106,360,420 N447Y probably damaging Het
Vmn1r81 A T 7: 12,259,847 I278K probably damaging Het
Other mutations in Olfr1221
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Olfr1221 APN 2 89111679 missense probably benign 0.19
IGL01965:Olfr1221 APN 2 89112191 missense probably benign 0.37
IGL02645:Olfr1221 APN 2 89111619 missense probably benign 0.00
PIT4354001:Olfr1221 UTSW 2 89112486 nonsense probably null
R0124:Olfr1221 UTSW 2 89111744 missense possibly damaging 0.56
R0940:Olfr1221 UTSW 2 89112075 missense probably benign
R3689:Olfr1221 UTSW 2 89112042 missense possibly damaging 0.85
R4489:Olfr1221 UTSW 2 89111572 splice site probably null
R4706:Olfr1221 UTSW 2 89112232 missense probably damaging 0.98
R4707:Olfr1221 UTSW 2 89112232 missense probably damaging 0.98
R5133:Olfr1221 UTSW 2 89111796 splice site probably null
R6629:Olfr1221 UTSW 2 89112162 missense probably benign 0.09
R6644:Olfr1221 UTSW 2 89111981 missense probably benign 0.00
R6723:Olfr1221 UTSW 2 89112296 missense possibly damaging 0.81
R6725:Olfr1221 UTSW 2 89112296 missense possibly damaging 0.81
R6765:Olfr1221 UTSW 2 89112296 missense possibly damaging 0.81
R6766:Olfr1221 UTSW 2 89112296 missense possibly damaging 0.81
R7215:Olfr1221 UTSW 2 89112501 nonsense probably null
R7562:Olfr1221 UTSW 2 89112285 missense probably benign 0.00
R7681:Olfr1221 UTSW 2 89111591 missense probably benign 0.00
R7981:Olfr1221 UTSW 2 89112056 missense probably damaging 1.00
R8318:Olfr1221 UTSW 2 89111898 missense probably benign 0.02
R8425:Olfr1221 UTSW 2 89112393 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGGGTTTGCAAATAGCCAC -3'
(R):5'- TCCATCTTCTCGAGAATCATGC -3'

Sequencing Primer
(F):5'- CATAACGGTCATAGGCCATAGCTG -3'
(R):5'- TCAAAGCCTTGTCAATGAGTTC -3'
Posted On2018-08-01