Incidental Mutation 'R6754:Nr1h5'
ID530947
Institutional Source Beutler Lab
Gene Symbol Nr1h5
Ensembl Gene ENSMUSG00000048938
Gene Namenuclear receptor subfamily 1, group H, member 5
SynonymsFXRB
Accession Numbers

Ncbi RefSeq: NM_198658.2, NM_201619.2, NM_201622.2

Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R6754 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location102939658-102964133 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102949597 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 200 (S200P)
Ref Sequence ENSEMBL: ENSMUSP00000142345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058899] [ENSMUST00000196135] [ENSMUST00000196983] [ENSMUST00000197412] [ENSMUST00000198472]
Predicted Effect probably damaging
Transcript: ENSMUST00000058899
AA Change: S200P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052557
Gene: ENSMUSG00000048938
AA Change: S200P

DomainStartEndE-ValueType
Blast:HOLI 2 47 5e-9 BLAST
ZnF_C4 119 190 2.51e-36 SMART
HOLI 289 474 1.74e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083774
Predicted Effect probably damaging
Transcript: ENSMUST00000196135
AA Change: S142P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143445
Gene: ENSMUSG00000048938
AA Change: S142P

DomainStartEndE-ValueType
ZnF_C4 78 132 1.17e-7 SMART
HOLI 231 416 1.74e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000196983
AA Change: S200P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142799
Gene: ENSMUSG00000048938
AA Change: S200P

DomainStartEndE-ValueType
Blast:HOLI 2 47 5e-9 BLAST
ZnF_C4 119 190 2.51e-36 SMART
HOLI 289 466 1.76e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000197412
AA Change: S200P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143764
Gene: ENSMUSG00000048938
AA Change: S200P

DomainStartEndE-ValueType
Blast:HOLI 2 47 4e-9 BLAST
ZnF_C4 119 190 1e-38 SMART
Pfam:Hormone_recep 274 362 6e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000198472
AA Change: S200P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142345
Gene: ENSMUSG00000048938
AA Change: S200P

DomainStartEndE-ValueType
Blast:HOLI 2 47 4e-9 BLAST
ZnF_C4 119 190 1e-38 SMART
Pfam:Hormone_recep 273 367 5.8e-6 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.2%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T C 17: 56,883,358 F352L probably damaging Het
Acta2 T C 19: 34,244,983 D246G probably damaging Het
Ank2 A G 3: 127,096,839 probably benign Het
Bmpr2 T A 1: 59,870,280 I971N probably damaging Het
C9 C A 15: 6,489,943 C8* probably null Het
Casp2 T A 6: 42,269,330 N207K probably damaging Het
Cd302 T G 2: 60,272,107 D56A probably benign Het
Cecr2 C T 6: 120,757,578 P605S probably damaging Het
Cep152 A G 2: 125,587,668 V723A probably damaging Het
Col17a1 C T 19: 47,650,721 probably null Het
Ctsk T C 3: 95,502,685 V168A probably damaging Het
Cyp2c54 A T 19: 40,071,560 N176K probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
F5 A G 1: 164,193,763 D1269G probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Hivep2 G A 10: 14,129,638 G660D probably benign Het
Hspb3 A T 13: 113,663,152 I114K probably damaging Het
Itgb7 T G 15: 102,216,160 *807C probably null Het
Kbtbd2 A G 6: 56,779,254 V499A probably damaging Het
Lemd3 A T 10: 120,933,660 I589N probably damaging Het
Mettl13 T C 1: 162,548,123 Y45C probably damaging Het
Mllt6 C T 11: 97,674,447 T571I probably damaging Het
Mrvi1 G A 7: 110,929,512 P43S probably damaging Het
Nabp1 A G 1: 51,474,540 I99T probably damaging Het
Ndufa4 A G 6: 11,906,053 V33A probably benign Het
Ntsr1 G A 2: 180,542,683 R393H probably benign Het
Olfr115 T C 17: 37,610,155 N199D probably benign Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Pcdhb21 A T 18: 37,514,683 K288N probably benign Het
Pla2g6 T C 15: 79,306,310 N351D probably benign Het
Polg T C 7: 79,459,836 E411G probably damaging Het
Ppp1r32 A T 19: 10,477,089 Y328N probably damaging Het
Prdm11 A G 2: 93,013,792 L31P probably damaging Het
Rab27b G A 18: 69,996,103 T40I probably damaging Het
Rnf219 C T 14: 104,503,414 E191K probably damaging Het
Ruvbl2 T C 7: 45,428,758 D97G probably benign Het
Sema3a T C 5: 13,599,275 V664A possibly damaging Het
Sh2d3c T C 2: 32,754,530 S842P probably damaging Het
Spam1 A G 6: 24,796,316 T89A probably damaging Het
Stab1 C T 14: 31,141,081 G2187E probably benign Het
Tff2 C A 17: 31,144,233 A6S probably benign Het
Trim80 T C 11: 115,448,174 V610A probably damaging Het
Trp53bp1 A G 2: 121,270,576 V47A possibly damaging Het
Ufl1 G A 4: 25,267,796 Q292* probably null Het
Ulk1 A T 5: 110,790,393 V571E possibly damaging Het
Usp24 A T 4: 106,360,420 N447Y probably damaging Het
Vmn1r81 A T 7: 12,259,847 I278K probably damaging Het
Other mutations in Nr1h5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01829:Nr1h5 APN 3 102949079 missense probably benign 0.02
IGL02021:Nr1h5 APN 3 102947742 intron probably benign
IGL02025:Nr1h5 APN 3 102949626 splice site probably benign
IGL02094:Nr1h5 APN 3 102952196 nonsense probably null
R0035:Nr1h5 UTSW 3 102949573 nonsense probably null
R0035:Nr1h5 UTSW 3 102949573 nonsense probably null
R1200:Nr1h5 UTSW 3 102947862 missense probably damaging 1.00
R1977:Nr1h5 UTSW 3 102947817 missense probably damaging 1.00
R4173:Nr1h5 UTSW 3 102952230 missense probably damaging 1.00
R4556:Nr1h5 UTSW 3 102946141 missense probably benign 0.28
R5018:Nr1h5 UTSW 3 102947795 missense probably damaging 1.00
R5471:Nr1h5 UTSW 3 102949126 missense possibly damaging 0.74
R5617:Nr1h5 UTSW 3 102947829 missense probably damaging 1.00
R5822:Nr1h5 UTSW 3 102949328 missense probably damaging 1.00
R6243:Nr1h5 UTSW 3 102949064 missense probably benign 0.00
R6442:Nr1h5 UTSW 3 102941111 missense probably damaging 1.00
R6789:Nr1h5 UTSW 3 102958361 missense possibly damaging 0.81
R7235:Nr1h5 UTSW 3 102949042 critical splice donor site probably null
R7294:Nr1h5 UTSW 3 102945262 missense probably benign 0.00
X0061:Nr1h5 UTSW 3 102945248 splice site probably null
X0067:Nr1h5 UTSW 3 102949126 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- AACAGAGGGCGCCTGTAATG -3'
(R):5'- CACTTCCAAGATGCAACTAATGTG -3'

Sequencing Primer
(F):5'- CCTGTAATGTGTGCTTGTTACAC -3'
(R):5'- CCAAGATGCAACTAATGTGTAAATC -3'
Posted On2018-08-01