Incidental Mutation 'R6754:Vmn1r81'
ID530958
Institutional Source Beutler Lab
Gene Symbol Vmn1r81
Ensembl Gene ENSMUSG00000115027
Gene Namevomeronasal 1 receptor 81
SynonymsV1rg9
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.837) question?
Stock #R6754 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location12247241-12268269 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12259847 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 278 (I278K)
Ref Sequence ENSEMBL: ENSMUSP00000153767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086232] [ENSMUST00000227080] [ENSMUST00000227973] [ENSMUST00000228482] [ENSMUST00000228764]
Predicted Effect probably damaging
Transcript: ENSMUST00000086232
AA Change: I278K

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000083409
Gene: ENSMUSG00000115027
AA Change: I278K

DomainStartEndE-ValueType
Pfam:TAS2R 3 301 5.4e-12 PFAM
Pfam:V1R 34 299 6.6e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227080
Predicted Effect probably damaging
Transcript: ENSMUST00000227973
AA Change: I278K

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000228482
Predicted Effect probably damaging
Transcript: ENSMUST00000228764
AA Change: I278K

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T C 17: 56,883,358 F352L probably damaging Het
Acta2 T C 19: 34,244,983 D246G probably damaging Het
Ank2 A G 3: 127,096,839 probably benign Het
Bmpr2 T A 1: 59,870,280 I971N probably damaging Het
C9 C A 15: 6,489,943 C8* probably null Het
Casp2 T A 6: 42,269,330 N207K probably damaging Het
Cd302 T G 2: 60,272,107 D56A probably benign Het
Cecr2 C T 6: 120,757,578 P605S probably damaging Het
Cep152 A G 2: 125,587,668 V723A probably damaging Het
Col17a1 C T 19: 47,650,721 probably null Het
Ctsk T C 3: 95,502,685 V168A probably damaging Het
Cyp2c54 A T 19: 40,071,560 N176K probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
F5 A G 1: 164,193,763 D1269G probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Hivep2 G A 10: 14,129,638 G660D probably benign Het
Hspb3 A T 13: 113,663,152 I114K probably damaging Het
Itgb7 T G 15: 102,216,160 *807C probably null Het
Kbtbd2 A G 6: 56,779,254 V499A probably damaging Het
Lemd3 A T 10: 120,933,660 I589N probably damaging Het
Mettl13 T C 1: 162,548,123 Y45C probably damaging Het
Mllt6 C T 11: 97,674,447 T571I probably damaging Het
Mrvi1 G A 7: 110,929,512 P43S probably damaging Het
Nabp1 A G 1: 51,474,540 I99T probably damaging Het
Ndufa4 A G 6: 11,906,053 V33A probably benign Het
Nr1h5 A G 3: 102,949,597 S200P probably damaging Het
Ntsr1 G A 2: 180,542,683 R393H probably benign Het
Olfr115 T C 17: 37,610,155 N199D probably benign Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Pcdhb21 A T 18: 37,514,683 K288N probably benign Het
Pla2g6 T C 15: 79,306,310 N351D probably benign Het
Polg T C 7: 79,459,836 E411G probably damaging Het
Ppp1r32 A T 19: 10,477,089 Y328N probably damaging Het
Prdm11 A G 2: 93,013,792 L31P probably damaging Het
Rab27b G A 18: 69,996,103 T40I probably damaging Het
Rnf219 C T 14: 104,503,414 E191K probably damaging Het
Ruvbl2 T C 7: 45,428,758 D97G probably benign Het
Sema3a T C 5: 13,599,275 V664A possibly damaging Het
Sh2d3c T C 2: 32,754,530 S842P probably damaging Het
Spam1 A G 6: 24,796,316 T89A probably damaging Het
Stab1 C T 14: 31,141,081 G2187E probably benign Het
Tff2 C A 17: 31,144,233 A6S probably benign Het
Trim80 T C 11: 115,448,174 V610A probably damaging Het
Trp53bp1 A G 2: 121,270,576 V47A possibly damaging Het
Ufl1 G A 4: 25,267,796 Q292* probably null Het
Ulk1 A T 5: 110,790,393 V571E possibly damaging Het
Usp24 A T 4: 106,360,420 N447Y probably damaging Het
Other mutations in Vmn1r81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02026:Vmn1r81 APN 7 12260505 missense probably damaging 1.00
IGL02086:Vmn1r81 APN 7 12259865 missense possibly damaging 0.82
IGL02751:Vmn1r81 APN 7 12260447 missense probably damaging 1.00
IGL02879:Vmn1r81 APN 7 12260392 missense probably benign 0.20
IGL03358:Vmn1r81 APN 7 12260305 missense possibly damaging 0.57
PIT4305001:Vmn1r81 UTSW 7 12260663 missense probably benign 0.01
R0359:Vmn1r81 UTSW 7 12259950 missense probably damaging 1.00
R1615:Vmn1r81 UTSW 7 12260514 missense probably damaging 1.00
R1938:Vmn1r81 UTSW 7 12260662 missense possibly damaging 0.67
R2967:Vmn1r81 UTSW 7 12260037 missense probably damaging 0.99
R2983:Vmn1r81 UTSW 7 12260669 missense probably benign 0.02
R4549:Vmn1r81 UTSW 7 12259822 missense probably damaging 0.99
R5099:Vmn1r81 UTSW 7 12260321 missense possibly damaging 0.86
R5326:Vmn1r81 UTSW 7 12260107 missense probably damaging 1.00
R5542:Vmn1r81 UTSW 7 12260107 missense probably damaging 1.00
R6010:Vmn1r81 UTSW 7 12260422 missense possibly damaging 0.88
R6630:Vmn1r81 UTSW 7 12260657 nonsense probably null
R6724:Vmn1r81 UTSW 7 12260672 missense probably damaging 1.00
R8198:Vmn1r81 UTSW 7 12259955 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- AACAGTGGTCTTAGTGCTCTG -3'
(R):5'- GGCCTGCTCAAGTGTCTCTATG -3'

Sequencing Primer
(F):5'- CAGTGGTCTTAGTGCTCTGCAATTG -3'
(R):5'- AGTCAAGCATATCCATAGTGCTC -3'
Posted On2018-08-01