Incidental Mutation 'R6754:Polg'
ID530960
Institutional Source Beutler Lab
Gene Symbol Polg
Ensembl Gene ENSMUSG00000039176
Gene Namepolymerase (DNA directed), gamma
SynonymsPol gamma, Polga, mitochondrial DNA polymerase gamma, mitochondrial DNA polymerase-gamma, polymerase gamma
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6754 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location79446231-79466362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79459836 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 411 (E411G)
Ref Sequence ENSEMBL: ENSMUSP00000119616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073889] [ENSMUST00000132048] [ENSMUST00000149444]
Predicted Effect probably damaging
Transcript: ENSMUST00000073889
AA Change: E411G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073551
Gene: ENSMUSG00000039176
AA Change: E411G

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
low complexity region 131 149 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
POLAc 849 1123 2.23e-107 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127734
Predicted Effect probably benign
Transcript: ENSMUST00000132048
SMART Domains Protein: ENSMUSP00000143933
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
PDB:3IKM|D 53 203 2e-71 PDB
SCOP:d1qm9a1 76 122 3e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139597
Predicted Effect probably benign
Transcript: ENSMUST00000139668
SMART Domains Protein: ENSMUSP00000114414
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
PDB:3IKM|D 13 236 1e-125 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142915
Predicted Effect probably benign
Transcript: ENSMUST00000143672
SMART Domains Protein: ENSMUSP00000122286
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
PDB:3IKM|D 2 243 1e-117 PDB
SCOP:d1t7pa2 141 243 1e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000149444
AA Change: E411G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119616
Gene: ENSMUSG00000039176
AA Change: E411G

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
PDB:3IKM|D 53 490 N/A PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201557
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial DNA polymerase is heterotrimeric, consisting of a homodimer of accessory subunits plus a catalytic subunit. The protein encoded by this gene is the catalytic subunit of mitochondrial DNA polymerase. The encoded protein contains a polyglutamine tract near its N-terminus that may be polymorphic. Defects in this gene are a cause of progressive external ophthalmoplegia with mitochondrial DNA deletions 1 (PEOA1), sensory ataxic neuropathy dysarthria and ophthalmoparesis (SANDO), Alpers-Huttenlocher syndrome (AHS), and mitochondrial neurogastrointestinal encephalopathy syndrome (MNGIE). Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous proof-reading deficient mutants display reduced life spans and premature aging with weight loss, decreased subcutaneous fat, alopecia, kyphosis, osteoporosis, anemia, reduced fertility, and enlarged hearts. Homozygous null mice display embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T C 17: 56,883,358 F352L probably damaging Het
Acta2 T C 19: 34,244,983 D246G probably damaging Het
Ank2 A G 3: 127,096,839 probably benign Het
Bmpr2 T A 1: 59,870,280 I971N probably damaging Het
C9 C A 15: 6,489,943 C8* probably null Het
Casp2 T A 6: 42,269,330 N207K probably damaging Het
Cd302 T G 2: 60,272,107 D56A probably benign Het
Cecr2 C T 6: 120,757,578 P605S probably damaging Het
Cep152 A G 2: 125,587,668 V723A probably damaging Het
Col17a1 C T 19: 47,650,721 probably null Het
Ctsk T C 3: 95,502,685 V168A probably damaging Het
Cyp2c54 A T 19: 40,071,560 N176K probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
F5 A G 1: 164,193,763 D1269G probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Hivep2 G A 10: 14,129,638 G660D probably benign Het
Hspb3 A T 13: 113,663,152 I114K probably damaging Het
Itgb7 T G 15: 102,216,160 *807C probably null Het
Kbtbd2 A G 6: 56,779,254 V499A probably damaging Het
Lemd3 A T 10: 120,933,660 I589N probably damaging Het
Mettl13 T C 1: 162,548,123 Y45C probably damaging Het
Mllt6 C T 11: 97,674,447 T571I probably damaging Het
Mrvi1 G A 7: 110,929,512 P43S probably damaging Het
Nabp1 A G 1: 51,474,540 I99T probably damaging Het
Ndufa4 A G 6: 11,906,053 V33A probably benign Het
Nr1h5 A G 3: 102,949,597 S200P probably damaging Het
Ntsr1 G A 2: 180,542,683 R393H probably benign Het
Olfr115 T C 17: 37,610,155 N199D probably benign Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Pcdhb21 A T 18: 37,514,683 K288N probably benign Het
Pla2g6 T C 15: 79,306,310 N351D probably benign Het
Ppp1r32 A T 19: 10,477,089 Y328N probably damaging Het
Prdm11 A G 2: 93,013,792 L31P probably damaging Het
Rab27b G A 18: 69,996,103 T40I probably damaging Het
Rnf219 C T 14: 104,503,414 E191K probably damaging Het
Ruvbl2 T C 7: 45,428,758 D97G probably benign Het
Sema3a T C 5: 13,599,275 V664A possibly damaging Het
Sh2d3c T C 2: 32,754,530 S842P probably damaging Het
Spam1 A G 6: 24,796,316 T89A probably damaging Het
Stab1 C T 14: 31,141,081 G2187E probably benign Het
Tff2 C A 17: 31,144,233 A6S probably benign Het
Trim80 T C 11: 115,448,174 V610A probably damaging Het
Trp53bp1 A G 2: 121,270,576 V47A possibly damaging Het
Ufl1 G A 4: 25,267,796 Q292* probably null Het
Ulk1 A T 5: 110,790,393 V571E possibly damaging Het
Usp24 A T 4: 106,360,420 N447Y probably damaging Het
Vmn1r81 A T 7: 12,259,847 I278K probably damaging Het
Other mutations in Polg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:Polg APN 7 79451925 missense probably damaging 1.00
IGL00970:Polg APN 7 79451745 missense probably benign 0.01
IGL01883:Polg APN 7 79458318 missense probably damaging 1.00
IGL02124:Polg APN 7 79459737 missense probably damaging 1.00
IGL02127:Polg APN 7 79458167 unclassified probably benign
IGL02820:Polg APN 7 79459771 missense possibly damaging 0.92
IGL03075:Polg APN 7 79451912 missense probably damaging 1.00
IGL03180:Polg APN 7 79451853 splice site probably benign
IGL03198:Polg APN 7 79451722 missense probably damaging 1.00
IGL03222:Polg APN 7 79454656 missense probably damaging 0.98
R0030:Polg UTSW 7 79452128 missense probably damaging 1.00
R0064:Polg UTSW 7 79461884 missense probably damaging 1.00
R0064:Polg UTSW 7 79461884 missense probably damaging 1.00
R0416:Polg UTSW 7 79452240 unclassified probably benign
R0522:Polg UTSW 7 79460151 splice site probably benign
R0638:Polg UTSW 7 79460148 splice site probably benign
R1263:Polg UTSW 7 79459786 missense probably benign
R1831:Polg UTSW 7 79459770 missense probably benign 0.41
R1873:Polg UTSW 7 79456493 missense probably benign 0.04
R1906:Polg UTSW 7 79460322 missense probably damaging 1.00
R1997:Polg UTSW 7 79459231 missense probably damaging 1.00
R2127:Polg UTSW 7 79464928 missense probably damaging 1.00
R2155:Polg UTSW 7 79461720 missense possibly damaging 0.94
R2156:Polg UTSW 7 79461720 missense possibly damaging 0.94
R2173:Polg UTSW 7 79455593 missense probably damaging 0.99
R3720:Polg UTSW 7 79456791 nonsense probably null
R4082:Polg UTSW 7 79464828 missense probably damaging 1.00
R4127:Polg UTSW 7 79455537 missense probably damaging 1.00
R4510:Polg UTSW 7 79455522 missense probably benign 0.01
R4511:Polg UTSW 7 79455522 missense probably benign 0.01
R4571:Polg UTSW 7 79460379 missense probably damaging 1.00
R4888:Polg UTSW 7 79464605 missense probably damaging 1.00
R5008:Polg UTSW 7 79460074 missense probably damaging 1.00
R5095:Polg UTSW 7 79460300 missense possibly damaging 0.92
R5121:Polg UTSW 7 79464605 missense probably damaging 1.00
R5139:Polg UTSW 7 79450025 missense probably damaging 1.00
R5213:Polg UTSW 7 79454098 missense probably damaging 1.00
R5285:Polg UTSW 7 79465225 utr 5 prime probably benign
R5498:Polg UTSW 7 79454670 missense probably damaging 1.00
R5714:Polg UTSW 7 79451991 missense possibly damaging 0.53
R5940:Polg UTSW 7 79454071 missense possibly damaging 0.95
R6146:Polg UTSW 7 79450512 missense probably benign 0.02
R6791:Polg UTSW 7 79460109 missense probably benign 0.25
R6829:Polg UTSW 7 79460109 missense probably benign 0.25
R6913:Polg UTSW 7 79460657 missense probably damaging 0.97
R7644:Polg UTSW 7 79451668 missense probably damaging 1.00
R7879:Polg UTSW 7 79450644 missense probably benign 0.22
R7962:Polg UTSW 7 79450644 missense probably benign 0.22
Z1176:Polg UTSW 7 79453741 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCACCAGGCTAGGGTTAAG -3'
(R):5'- CCATTGTAATCAGGTAGGGCTG -3'

Sequencing Primer
(F):5'- GCTGAGCTAAAATTCAGGCCTC -3'
(R):5'- AATCAGGTAGGGCTGATTCTTCC -3'
Posted On2018-08-01